ID: 1063370173

View in Genome Browser
Species Human (GRCh38)
Location 10:5516084-5516106
Sequence AGACCTCCATGCTGGCCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063370173_1063370177 0 Left 1063370173 10:5516084-5516106 CCCAGGGGCCAGCATGGAGGTCT No data
Right 1063370177 10:5516107-5516129 CCAGCCACCACCGAGCCACATGG No data
1063370173_1063370183 16 Left 1063370173 10:5516084-5516106 CCCAGGGGCCAGCATGGAGGTCT No data
Right 1063370183 10:5516123-5516145 CACATGGCAAATGAGGACAGTGG No data
1063370173_1063370180 9 Left 1063370173 10:5516084-5516106 CCCAGGGGCCAGCATGGAGGTCT No data
Right 1063370180 10:5516116-5516138 ACCGAGCCACATGGCAAATGAGG No data
1063370173_1063370185 18 Left 1063370173 10:5516084-5516106 CCCAGGGGCCAGCATGGAGGTCT No data
Right 1063370185 10:5516125-5516147 CATGGCAAATGAGGACAGTGGGG No data
1063370173_1063370184 17 Left 1063370173 10:5516084-5516106 CCCAGGGGCCAGCATGGAGGTCT No data
Right 1063370184 10:5516124-5516146 ACATGGCAAATGAGGACAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063370173 Original CRISPR AGACCTCCATGCTGGCCCCT GGG (reversed) Intergenic
No off target data available for this crispr