ID: 1063370183

View in Genome Browser
Species Human (GRCh38)
Location 10:5516123-5516145
Sequence CACATGGCAAATGAGGACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063370173_1063370183 16 Left 1063370173 10:5516084-5516106 CCCAGGGGCCAGCATGGAGGTCT No data
Right 1063370183 10:5516123-5516145 CACATGGCAAATGAGGACAGTGG No data
1063370174_1063370183 15 Left 1063370174 10:5516085-5516107 CCAGGGGCCAGCATGGAGGTCTC No data
Right 1063370183 10:5516123-5516145 CACATGGCAAATGAGGACAGTGG No data
1063370175_1063370183 8 Left 1063370175 10:5516092-5516114 CCAGCATGGAGGTCTCCAGCCAC No data
Right 1063370183 10:5516123-5516145 CACATGGCAAATGAGGACAGTGG No data
1063370176_1063370183 -7 Left 1063370176 10:5516107-5516129 CCAGCCACCACCGAGCCACATGG No data
Right 1063370183 10:5516123-5516145 CACATGGCAAATGAGGACAGTGG No data
1063370170_1063370183 30 Left 1063370170 10:5516070-5516092 CCTTAGCAGCTGCTCCCAGGGGC No data
Right 1063370183 10:5516123-5516145 CACATGGCAAATGAGGACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063370183 Original CRISPR CACATGGCAAATGAGGACAG TGG Intergenic
No off target data available for this crispr