ID: 1063370185

View in Genome Browser
Species Human (GRCh38)
Location 10:5516125-5516147
Sequence CATGGCAAATGAGGACAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063370174_1063370185 17 Left 1063370174 10:5516085-5516107 CCAGGGGCCAGCATGGAGGTCTC No data
Right 1063370185 10:5516125-5516147 CATGGCAAATGAGGACAGTGGGG No data
1063370176_1063370185 -5 Left 1063370176 10:5516107-5516129 CCAGCCACCACCGAGCCACATGG No data
Right 1063370185 10:5516125-5516147 CATGGCAAATGAGGACAGTGGGG No data
1063370178_1063370185 -9 Left 1063370178 10:5516111-5516133 CCACCACCGAGCCACATGGCAAA No data
Right 1063370185 10:5516125-5516147 CATGGCAAATGAGGACAGTGGGG No data
1063370173_1063370185 18 Left 1063370173 10:5516084-5516106 CCCAGGGGCCAGCATGGAGGTCT No data
Right 1063370185 10:5516125-5516147 CATGGCAAATGAGGACAGTGGGG No data
1063370175_1063370185 10 Left 1063370175 10:5516092-5516114 CCAGCATGGAGGTCTCCAGCCAC No data
Right 1063370185 10:5516125-5516147 CATGGCAAATGAGGACAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063370185 Original CRISPR CATGGCAAATGAGGACAGTG GGG Intergenic
No off target data available for this crispr