ID: 1063370948

View in Genome Browser
Species Human (GRCh38)
Location 10:5522976-5522998
Sequence CTGCACACACAGCTTGCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063370948_1063370957 30 Left 1063370948 10:5522976-5522998 CCTTGAGCAAGCTGTGTGTGCAG No data
Right 1063370957 10:5523029-5523051 ATCTCCAGAATATTCGAGGAAGG No data
1063370948_1063370956 26 Left 1063370948 10:5522976-5522998 CCTTGAGCAAGCTGTGTGTGCAG No data
Right 1063370956 10:5523025-5523047 AGAGATCTCCAGAATATTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063370948 Original CRISPR CTGCACACACAGCTTGCTCA AGG (reversed) Intergenic
No off target data available for this crispr