ID: 1063371299

View in Genome Browser
Species Human (GRCh38)
Location 10:5524665-5524687
Sequence GCGGCAGGTGGGAGACGGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 670
Summary {0: 1, 1: 0, 2: 1, 3: 51, 4: 617}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063371287_1063371299 24 Left 1063371287 10:5524618-5524640 CCACTCAAGGGAAGAAAGGGCAC 0: 1
1: 0
2: 0
3: 17
4: 160
Right 1063371299 10:5524665-5524687 GCGGCAGGTGGGAGACGGGGAGG 0: 1
1: 0
2: 1
3: 51
4: 617
1063371283_1063371299 28 Left 1063371283 10:5524614-5524636 CCCTCCACTCAAGGGAAGAAAGG 0: 1
1: 0
2: 2
3: 23
4: 231
Right 1063371299 10:5524665-5524687 GCGGCAGGTGGGAGACGGGGAGG 0: 1
1: 0
2: 1
3: 51
4: 617
1063371285_1063371299 27 Left 1063371285 10:5524615-5524637 CCTCCACTCAAGGGAAGAAAGGG 0: 1
1: 0
2: 1
3: 27
4: 278
Right 1063371299 10:5524665-5524687 GCGGCAGGTGGGAGACGGGGAGG 0: 1
1: 0
2: 1
3: 51
4: 617

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063371299 Original CRISPR GCGGCAGGTGGGAGACGGGG AGG Exonic
900178156 1:1299715-1299737 AGGGCAGGTGGGAGACAGGCAGG + Intronic
900191799 1:1355211-1355233 GCGGGAGCTGGGGGGCGGGGGGG + Intronic
900226290 1:1535027-1535049 GGGGCAGGTGGGGGCAGGGGCGG - Intergenic
900345665 1:2209162-2209184 GCAGCAGGTGGGGGACGGAGTGG - Intronic
900472672 1:2862597-2862619 GCGGCAGGTGTGAGGAGGCGGGG - Intergenic
900497147 1:2980916-2980938 GCGGCAGCTGGGGGTGGGGGCGG + Intergenic
900523852 1:3119048-3119070 CCGGGAGGTGGGAGACGGTATGG + Intronic
900627660 1:3616576-3616598 GCCGGGGGTGAGAGACGGGGTGG + Intergenic
900787144 1:4655976-4655998 TCGGCAGCTGGGAGCCTGGGAGG - Intronic
900887127 1:5423082-5423104 GTGGCAGGTGGGAGACAGCCTGG - Intergenic
900985985 1:6072972-6072994 GAGGCAGGTGGGAGGGGGGCTGG + Intronic
901489321 1:9588787-9588809 GCCGCAGGCGGGACGCGGGGCGG - Intergenic
901641038 1:10693210-10693232 GAGGCAGGTGGGAGACAGTCCGG + Intronic
901882059 1:12199736-12199758 GCGGGAGGTGAGAGCAGGGGTGG - Intronic
902612255 1:17604020-17604042 GCCGCAGAAGGGAGATGGGGCGG + Intronic
902625385 1:17673332-17673354 CCGGCAGCAGGGAGAGGGGGAGG + Intronic
902652476 1:17845543-17845565 GCAGCAGGTTGGAGAAGGTGAGG - Intergenic
902990566 1:20184793-20184815 GAGGGAGGTGGGAGAGGGAGAGG + Intergenic
903577262 1:24346676-24346698 GAGGGAGGTGGGAGCTGGGGTGG - Intronic
904039261 1:27575018-27575040 TCCGCAGTTGGGAGGCGGGGCGG + Intronic
904753274 1:32754174-32754196 CCGGCAGGTAGGGGCCGGGGTGG + Intronic
904773474 1:32893634-32893656 GGGGCAGGGGCGGGACGGGGTGG + Intronic
905037478 1:34927537-34927559 GTGGCGGGTGGGAGATGCGGGGG + Intronic
905308488 1:37034407-37034429 GGGGCAGGTGGGAGCCCGCGCGG - Intergenic
905317341 1:37091739-37091761 GTGGCAGGCGGGGGGCGGGGCGG - Intergenic
905548790 1:38819461-38819483 GGGGAAGGTGGGAGCCCGGGGGG + Intergenic
905886264 1:41493745-41493767 GAGGCAGGTGGAAGAGGGGATGG + Intergenic
906321740 1:44821535-44821557 GCAGCAGGTGGAAGGCGAGGTGG - Intronic
906518374 1:46452859-46452881 ATGGCAGGTGGAAGGCGGGGAGG - Intergenic
907217438 1:52877116-52877138 GGGGCTGGGGGGAGAGGGGGAGG - Intronic
907301590 1:53490247-53490269 GAGGAAGGTGGGAGACAGGGTGG - Intergenic
908434355 1:64090756-64090778 GAGATAGGTGGGAGATGGGGAGG + Intronic
908465873 1:64394625-64394647 GGGGCAGGGTGGAGACTGGGGGG - Intergenic
912390167 1:109297392-109297414 GGGGGAAGTGGGAGATGGGGGGG - Intronic
913215145 1:116613885-116613907 GCTGCAGGTGGAAGATGGTGAGG + Exonic
914376397 1:147077344-147077366 GGGGCAGGTGGGAGGCGCGCGGG - Intergenic
914790808 1:150876314-150876336 GGGGCAGGTGGGAGTTGAGGGGG - Intronic
914817086 1:151071079-151071101 GCGGCGGGAGGGGGACGGGGAGG + Intronic
915358133 1:155268841-155268863 GGGGCCGGAGGGAGGCGGGGTGG + Intronic
915598411 1:156908063-156908085 GGGGCGGGCGGGAGACGGGAGGG + Intronic
915835493 1:159172361-159172383 GCGGGTGGTGGGGGACGGGCGGG - Intronic
916325000 1:163546483-163546505 TCGGCATGAGGGAGAGGGGGAGG + Intergenic
916490987 1:165302198-165302220 GAGGCCGGTGGGGGGCGGGGTGG + Intronic
916588096 1:166165843-166165865 GAGGGAGGTGGGAGAGGAGGCGG + Intronic
916779419 1:168008856-168008878 GGGGCAGGGTGGAGGCGGGGTGG - Intronic
917481680 1:175417328-175417350 GCAGTGGGTGGGAGAGGGGGCGG + Intronic
917725222 1:177821374-177821396 GAGGAAGGAGGGAGAAGGGGAGG + Intergenic
917848609 1:179041653-179041675 ACGGGAGATGGGAGACAGGGAGG + Intronic
917848620 1:179041684-179041706 GAGGGAGACGGGAGACGGGGAGG + Intronic
918659094 1:187067320-187067342 GTGCCAGGTGGGAGGCAGGGTGG + Intergenic
919791224 1:201292125-201292147 GAGGCAGGTGGCAAACGAGGCGG + Intronic
920400335 1:205672209-205672231 GAGGCACGTGGGTGAGGGGGGGG - Intronic
920850282 1:209623761-209623783 GGAGCAGGAGGGAGAGGGGGTGG + Intronic
921055817 1:211541700-211541722 GCTTCTGGTGGGAGATGGGGAGG - Intergenic
922526616 1:226309065-226309087 GCAGCAGGCGGGAAAAGGGGGGG + Intronic
922798497 1:228353238-228353260 GCCACAGATGGTAGACGGGGAGG + Intronic
923141063 1:231162095-231162117 GCGGCGGGAGGGAGGCGGGGAGG + Intronic
923784500 1:237054315-237054337 GGGGGAGGGGGGAGGCGGGGAGG - Intronic
924362298 1:243254792-243254814 GCGGCGGGTGGGGGATGGGAAGG + Intronic
924949028 1:248865855-248865877 GGGGCATATGGGAGACAGGGAGG + Intergenic
1062806264 10:422065-422087 GCGGCAGCTGAGATACCGGGAGG + Intronic
1062812538 10:477456-477478 GTGGGAGGTGGGAGGTGGGGAGG + Intronic
1062812552 10:477490-477512 GTGGGAGGTGGGAGGTGGGGAGG + Intronic
1062992920 10:1836812-1836834 GGTGCAGGTGGGAGAGGGGGCGG - Intergenic
1063371299 10:5524665-5524687 GCGGCAGGTGGGAGACGGGGAGG + Exonic
1063464143 10:6232246-6232268 GCGGGGGGTGGGTGGCGGGGGGG + Intronic
1065518755 10:26551655-26551677 GAAGCAGGTGAGCGACGGGGCGG - Intronic
1065963553 10:30753227-30753249 GCGGGAGGTGGGAGGTGGGCTGG - Intergenic
1067037462 10:42930943-42930965 GGGCCATGTGGGAGACGCGGTGG - Intergenic
1067606270 10:47666184-47666206 GCGGGGGGTGGGGGATGGGGGGG - Intergenic
1067659616 10:48224509-48224531 GAGGCAGGTGGCAGAGGGGATGG - Intronic
1067893284 10:50153601-50153623 GTGGCATGTGGGAGAGGGGACGG + Intergenic
1068316532 10:55351026-55351048 GGGGGAGGAGGGAGAGGGGGAGG - Intronic
1069713874 10:70508419-70508441 GCAGCAGGTTGGAGAAGGGCTGG + Intronic
1069738399 10:70672467-70672489 GCGGGAGCCGGGCGACGGGGCGG - Intergenic
1070304890 10:75234286-75234308 GCGGAAGGCGGGGGACTGGGAGG + Intronic
1070328643 10:75403304-75403326 GCGGCAGGTGGGAGAAGGTCGGG - Intergenic
1070805229 10:79266940-79266962 GAAGGAGGTGGGAGACGGGCAGG - Intronic
1070969551 10:80552282-80552304 GCAGCAGCTGGGAGAAGGGAAGG - Intronic
1071283945 10:84127020-84127042 GATGCAGGTAGGAGTCGGGGAGG - Intergenic
1071468157 10:85959519-85959541 GGGGCGGGTGGGAGACTGGCTGG - Intronic
1071621834 10:87127537-87127559 GCGGGGGGTGGCAGACGGGGTGG - Intronic
1073224177 10:101902697-101902719 GCGGGAGGTGGGAAAAGGAGGGG + Intronic
1073662800 10:105495771-105495793 GTGGCCGGTGGGGGATGGGGCGG - Intergenic
1074483811 10:113854138-113854160 GTGGCAGGTGGGGGGCGGTGAGG - Intronic
1074867049 10:117550778-117550800 GGGGGAGGAGGGAGACGGGGTGG + Intergenic
1076216556 10:128698201-128698223 TCAGCAGGTGGGAGACTTGGTGG - Intergenic
1076620804 10:131786165-131786187 GCGGCAGGTGATAGAGGGGAAGG - Intergenic
1076719310 10:132386316-132386338 GCAGCAGCTGGAAGGCGGGGTGG + Intergenic
1076806792 10:132862796-132862818 GAGGCTGGAGGGGGACGGGGCGG + Intronic
1076839854 10:133040611-133040633 GGGGCAGGTGGCAGGGGGGGGGG + Intergenic
1076944116 10:133632462-133632484 GTGGCAGGTGGGACCTGGGGAGG - Intergenic
1077229046 11:1450527-1450549 CCGGCGGGTGGGGGCCGGGGGGG - Intronic
1077307383 11:1874271-1874293 GGGGCAGGCCGGGGACGGGGGGG + Intronic
1077368604 11:2171308-2171330 GGGGCAGGTGGGAGTAGGGTGGG + Intronic
1077404121 11:2375210-2375232 GGGGCAGGTGTGAGCCTGGGAGG - Intergenic
1077423354 11:2463097-2463119 GTGGGAAGTGGGGGACGGGGTGG + Intronic
1077483426 11:2827171-2827193 AGGGCAGGTGGGAGAAGGGGAGG + Intronic
1077495846 11:2886148-2886170 GCGGGGGGCGGGAGCCGGGGGGG - Intergenic
1077544278 11:3162404-3162426 GCTTGAGGTGGGAGATGGGGAGG - Intronic
1077555822 11:3225561-3225583 GGGGCAGGTGGGAGCCTGGACGG + Intergenic
1078066193 11:8081041-8081063 GCCGAAGGTGGGAGCCGGCGCGG + Intronic
1078359442 11:10657039-10657061 GCAGCAGGTGGAGGACGCGGAGG + Intronic
1079689601 11:23404364-23404386 GCTGCAGGTGGGAGCCCGTGTGG - Intergenic
1080602674 11:33835202-33835224 GCAGAAAGTGGGAGAAGGGGAGG - Intergenic
1083192371 11:61061581-61061603 GAGGGAGGTGGGAGTGGGGGTGG - Intergenic
1083579090 11:63813540-63813562 GCGGCGGGCGGGCGGCGGGGAGG + Exonic
1083656287 11:64231219-64231241 GTGGGGGGTGGGAGATGGGGAGG + Intronic
1083793186 11:64999168-64999190 GAGGCAGCTGGGAGAGGGAGTGG + Intergenic
1083890102 11:65591767-65591789 GCGGGGGGTGGGTGGCGGGGGGG - Intronic
1084070014 11:66728032-66728054 GCGGCCGGGGTGAGCCGGGGCGG - Intronic
1084169857 11:67395859-67395881 GTGGCAGGTGGGAGAGGGGCGGG + Intronic
1084263150 11:67991557-67991579 GGCGCAGGGGGGAGACGGGCCGG - Exonic
1084399701 11:68936514-68936536 GCGGCAGGAGGGAGGCCAGGAGG + Exonic
1084412632 11:69013287-69013309 CCGGCAGGAGGGGGAGGGGGAGG + Exonic
1084453015 11:69251184-69251206 AGGGCAGGTGGGAGGCGGTGGGG + Intergenic
1084582475 11:70032521-70032543 GAGGGAGGCGGGAGAGGGGGGGG + Intergenic
1084612141 11:70210045-70210067 GCGGCAGGTAGCAGAAGAGGTGG - Intergenic
1085395312 11:76204222-76204244 GGGGGAGGTGGGAAAAGGGGTGG - Intronic
1085597025 11:77820178-77820200 CCGCCAAGGGGGAGACGGGGTGG + Intronic
1086233703 11:84600267-84600289 GCGGCAGGCCGGACACAGGGAGG + Intronic
1088604081 11:111512410-111512432 GGGGCGGGCGCGAGACGGGGCGG - Intergenic
1088875870 11:113935808-113935830 GCGGGAGGTTGGGGACGGGTAGG + Intronic
1089333927 11:117709654-117709676 GCTGGAGGTGGGAGTTGGGGTGG - Intronic
1090056184 11:123426998-123427020 GCTGCAGGTGGGGAAAGGGGAGG + Intergenic
1090202005 11:124864010-124864032 GGGGTAGGTGGGAGTGGGGGTGG - Intergenic
1090747838 11:129721455-129721477 GGGGCAGGTGGGAGAAGGAAAGG - Intergenic
1091851253 12:3698946-3698968 GCAGCAGGTGGGAGTAGGGTGGG - Intronic
1092262639 12:6960694-6960716 GCGTCACCTGTGAGACGGGGTGG + Exonic
1092291156 12:7160186-7160208 GAGGCAGGTGGGAGGCAGGTGGG - Intergenic
1092291173 12:7160233-7160255 GAGGCAGGTGGGAGGAGAGGTGG - Intergenic
1092291184 12:7160267-7160289 GAGGCAGGTGGGAGGCAGGCGGG - Intergenic
1092291193 12:7160290-7160312 GAGGCAGGTGGGAGGAGAGGTGG - Intergenic
1092291204 12:7160324-7160346 GAGGCAGGTGGGAGGCAGGTGGG - Intergenic
1092291208 12:7160335-7160357 GAGGCAGGTGGGAGGCAGGTGGG - Intergenic
1092923754 12:13255991-13256013 GCGGCAGGGAGGAGAAGGGGAGG + Intergenic
1093958610 12:25250332-25250354 GCGGGAGCGGGGAGAGGGGGAGG + Intronic
1094348623 12:29498572-29498594 GGGGCAGGTGGGAGATGAGCAGG + Intergenic
1094843247 12:34350658-34350680 GCGGCAGGTGGGTCACGGTGCGG + Intergenic
1096657166 12:53098809-53098831 GGGGCAGCGGGGAGATGGGGAGG + Intronic
1097167108 12:57091717-57091739 GCAGCAGGTGGGACTGGGGGTGG + Exonic
1097823109 12:64147411-64147433 GGGGAAGGTGGGGGACAGGGAGG - Exonic
1099365199 12:81759177-81759199 GCGGCGGGGGGGCGGCGGGGGGG - Intronic
1100632001 12:96399504-96399526 GCGGGAGGTGGGCGAGGAGGCGG - Intronic
1100673777 12:96844857-96844879 GAGTCAGGTGGGAGAGGGAGAGG - Intronic
1101905806 12:108824932-108824954 GCGGGAGGTGGGGGAGGAGGAGG + Intronic
1102236621 12:111298081-111298103 GCAGGGGGTGGGAGACGCGGGGG - Intronic
1102474485 12:113179839-113179861 GTGACAGGTGGGACAAGGGGTGG + Intronic
1102651484 12:114445597-114445619 GAGGCGGGTGGGGGAGGGGGAGG - Intergenic
1103910507 12:124349595-124349617 GCGGCAGGTGTGAGACTGTAGGG - Intronic
1103939010 12:124491907-124491929 GCGGCAGGTAGGAAGCGGGAGGG + Intronic
1104047448 12:125173319-125173341 GCCCCAGGTGGGTGACTGGGTGG + Intergenic
1104580295 12:130006666-130006688 GCGGCAGACAGGAGACGGGAAGG - Intergenic
1104862745 12:131932959-131932981 GCGGCAGGTGCGAGAGAGTGAGG + Intronic
1104896960 12:132169228-132169250 GTGGCAGGGGGGAGACAGCGGGG + Intergenic
1104896986 12:132169296-132169318 GTGGCAGGGGGGAGACAGCGGGG + Intergenic
1104945783 12:132414360-132414382 GCGGCAGCTGGGACAGGGTGTGG - Intergenic
1104961432 12:132490208-132490230 GCGGCAGGCGGGAGGCGGCCGGG - Exonic
1104992241 12:132632356-132632378 GCAGCAAGTGGGAACCGGGGAGG + Exonic
1105218877 13:18307375-18307397 GCTGCAGGTGGAAGATGGTGAGG + Intergenic
1105401140 13:20097150-20097172 GCGGCGGGTGGGGGTGGGGGTGG + Intergenic
1108798740 13:54067078-54067100 GGGGCAGGTGGGGGTCAGGGTGG - Intergenic
1109796735 13:67324425-67324447 GGCGCAGGTGGAAGATGGGGTGG + Intergenic
1110772559 13:79366635-79366657 GTAACAGGTGGGAGACTGGGTGG + Exonic
1110971309 13:81765457-81765479 GCTGGTGGTGGGAGATGGGGAGG - Intergenic
1113618247 13:111695958-111695980 GCAGGAGGTGTGAGACGAGGGGG - Intergenic
1113623778 13:111781219-111781241 GCAGGAGGTGTGAGACGAGGGGG - Intergenic
1114618583 14:24081664-24081686 GGTGAAGGTGGGAGCCGGGGCGG - Intronic
1115562662 14:34597150-34597172 GGGGCAGGTGGGTGGAGGGGAGG - Intronic
1115645139 14:35364054-35364076 GGGGCAGGTGGGATGGGGGGTGG + Intergenic
1116522294 14:45864895-45864917 GCGGCAGTTGGGGGTCGGGGGGG - Intergenic
1119027322 14:71164431-71164453 TCTGCTGGTGGGAGGCGGGGTGG + Intergenic
1119188836 14:72664617-72664639 GGGGCAGGTGGGAGGTGGTGAGG - Intronic
1119681551 14:76596089-76596111 GCGGGGGGTGGGGGGCGGGGTGG - Intergenic
1119741293 14:77015280-77015302 GTGGCTGGTGGGAGAGGGAGGGG + Intergenic
1120219620 14:81717472-81717494 GTGGCAGGTGGGAGTCAGGAAGG + Intergenic
1120984525 14:90322321-90322343 GTGACAGGTGGGAGGAGGGGAGG - Intronic
1121384908 14:93511087-93511109 GTGGCAGGAGGGAGAGGTGGTGG + Intronic
1122220994 14:100239110-100239132 GCGGGCGGGGGGAGAGGGGGCGG - Exonic
1122464125 14:101918623-101918645 GGGTCAGGGGGGAGAGGGGGAGG - Intronic
1123020401 14:105395331-105395353 GGGGAAGGTGTGAGGCGGGGTGG - Exonic
1123040177 14:105487191-105487213 GCTGCAGGCGCGAGACTGGGTGG - Exonic
1123505934 15:20941410-20941432 CCGGCCGGTGGCAGGCGGGGTGG + Intergenic
1123563166 15:21515116-21515138 CCGGCCGGTGGCAGGCGGGGTGG + Intergenic
1123599415 15:21952399-21952421 CCGGCCGGTGGCAGGCGGGGTGG + Intergenic
1123956646 15:25342802-25342824 GGGGCAGGTGGTGGAGGGGGTGG - Intronic
1125051178 15:35299496-35299518 GCGGCAGCGCGGAGCCGGGGAGG + Intronic
1125310412 15:38372985-38373007 GCGGAGGGTGGGGGAGGGGGCGG - Intergenic
1128173295 15:65531199-65531221 GCCGGAGGTGGGGGAGGGGGAGG + Intronic
1128534766 15:68482081-68482103 GAGGCTGGTGGGGGACCGGGGGG + Intergenic
1128752855 15:70161393-70161415 GAGGCAGGTGGGGGGCGGAGAGG + Intergenic
1129333952 15:74841568-74841590 GAGGCAGATGTGAGCCGGGGAGG - Intronic
1130258175 15:82335412-82335434 GCGGGAGGCTGGAGAAGGGGCGG + Intergenic
1130384727 15:83401140-83401162 GAGGCAGGACGGAGAAGGGGAGG - Intergenic
1130596754 15:85254548-85254570 GCGGGAGGCTGGAGAAGGGGCGG - Intergenic
1131431736 15:92393836-92393858 GGGGCAGGCGGGAGCCGGGAGGG + Exonic
1131441705 15:92464437-92464459 CAGGCAGATGGGAGTCGGGGTGG + Exonic
1131578271 15:93614042-93614064 GAGGGAGGTGGGAGAGAGGGCGG + Intergenic
1131701557 15:94942657-94942679 GCGGCAGGGCGGGGGCGGGGGGG - Intergenic
1132092706 15:98958914-98958936 GGGGCAGGTGGGAGCAGGGATGG - Exonic
1132350146 15:101134248-101134270 GCTGCAGGTGAGAGCCGGGAAGG - Intergenic
1132398307 15:101489792-101489814 GCCGCGGGCGGGAGCCGGGGAGG + Exonic
1202971518 15_KI270727v1_random:242250-242272 CCGGCCGGTGGCAGGCGGGGTGG + Intergenic
1132565376 16:620042-620064 CAGGCAGGTGGAAGACGGGCAGG + Intronic
1132591564 16:728447-728469 GGGGCCGGCGGGAGGCGGGGTGG - Intronic
1132715604 16:1288628-1288650 TCGGCGGGTGGGAGTGGGGGTGG - Intergenic
1132984421 16:2756835-2756857 GAGGCACGTGGGAGAAGGGAGGG + Intronic
1133040130 16:3056236-3056258 GTGGCAAGGGGGAGACGGGTGGG + Intronic
1133744113 16:8674467-8674489 GAGGGAGGTGGCAGGCGGGGCGG - Intergenic
1134135648 16:11674787-11674809 TGGGCAGGTGGGAGGCAGGGAGG - Intronic
1136455805 16:30379002-30379024 GCCGCAGGTGAGACCCGGGGCGG - Exonic
1136913800 16:34163248-34163270 GCGGGGGGAGGGAGAAGGGGCGG - Intergenic
1137358527 16:47791182-47791204 GCAGCAGGAGAGAGAAGGGGAGG + Intergenic
1137596452 16:49727324-49727346 GCTCCAGGTTGGGGACGGGGGGG + Intronic
1138389206 16:56657986-56658008 GGGGCAGGTGGAAGGCGTGGTGG - Exonic
1138389926 16:56662884-56662906 GGGGCAGGTGGGAGGCATGGTGG + Intronic
1138391873 16:56676117-56676139 GGGGCAGGTGGGAGGCGTGGTGG - Exonic
1138501405 16:57447326-57447348 GCGGCAGGTGAGAGTGGTGGGGG - Exonic
1138747966 16:59385720-59385742 GCAGCAGGCGGGAGACTAGGGGG - Intergenic
1139475054 16:67199028-67199050 GCGGCAGGTGGGGGCGGGGAGGG - Intergenic
1139631732 16:68235618-68235640 GCAGCAGGTGAGCGCCGGGGTGG - Exonic
1140067628 16:71625165-71625187 GTGGAAGGTGGGTGACTGGGTGG + Intergenic
1140858234 16:78996762-78996784 GAGGCAGGTGGGAAGCGGGAAGG - Intronic
1141461303 16:84180125-84180147 GCGGCGTGTGGGAGATGGGGCGG - Intronic
1141630275 16:85283923-85283945 TGGGCAGGAGGGAGACGTGGTGG - Intergenic
1141680113 16:85538856-85538878 GGGACTGGTGGGAGATGGGGAGG - Intergenic
1141727554 16:85799746-85799768 GCGGCAGGTGAGACAGGAGGTGG + Exonic
1141806466 16:86345069-86345091 GAGGGAGGTGGAAGACGAGGAGG - Intergenic
1141819021 16:86432338-86432360 GTCAGAGGTGGGAGACGGGGTGG + Intergenic
1142175899 16:88645176-88645198 GTGGCAGCAGGGAGACGGGGGGG + Intronic
1142282317 16:89154970-89154992 GGGGCAGGTGGGGGTCTGGGTGG - Exonic
1142560084 17:804612-804634 GGGTGAGATGGGAGACGGGGAGG + Intronic
1142581967 17:948828-948850 GAGGCAGGGGGGAGAGGAGGAGG - Intronic
1142581989 17:948884-948906 GAGGCAGGGGGGAGAGGAGGAGG - Intronic
1142581997 17:948903-948925 GAGGCAGGGGGGAGAGGAGGAGG - Intronic
1142582005 17:948922-948944 GAGGCAGGGGGGAGAGGAGGAGG - Intronic
1142582013 17:948941-948963 GAGGCAGGGGGGAGAGGAGGAGG - Intronic
1142582084 17:949111-949133 GAGGCAGGGGGGAGAGGAGGAGG - Intronic
1142582112 17:949187-949209 GAGGCAGGGGGGAGAGGAGGAGG - Intronic
1142582140 17:949263-949285 GAGGCAGGGGGGAGAGGAGGAGG - Intronic
1142582168 17:949339-949361 GAGGCAGGGGGGAGAGGAGGAGG - Intronic
1142582196 17:949415-949437 GAGGCAGGGGGGAGAGGAGGAGG - Intronic
1142582223 17:949491-949513 GAGGCAGGGGGGAGAGGAGGAGG - Intronic
1142582238 17:949529-949551 GAGGCAGGGGGGAGAGGAGGAGG - Intronic
1142582259 17:949586-949608 GAGGCAGGGGGGAGAGGAGGAGG - Intronic
1142582274 17:949624-949646 GAGGCAGGGGGGAGAGGAGGAGG - Intronic
1142582295 17:949681-949703 GAGGCAGGGGGGAGAGGAGGAGG - Intronic
1142613835 17:1123962-1123984 GGGGCAGGTGGGAGGCAAGGGGG - Intronic
1142614249 17:1125571-1125593 GGGGCTGCTGGGAGGCGGGGAGG + Intronic
1142697102 17:1639790-1639812 GAGGCAGGCAGGAGACGGGCAGG + Intronic
1143129886 17:4671628-4671650 GGGGCTGGCGGGAGAAGGGGTGG - Intronic
1143659378 17:8315284-8315306 GCTGGAGGTGGGAGATGGGAGGG + Intronic
1144730633 17:17523913-17523935 CCGGCAGATGGGGGATGGGGAGG - Intronic
1144797611 17:17903011-17903033 GAGGCAGGTGGATGAAGGGGAGG - Intronic
1144922122 17:18772744-18772766 GGGGGTGGTGGGAGACGGGGAGG + Intronic
1146000612 17:29128189-29128211 GGGGGAGGTGGGGGAGGGGGTGG + Intronic
1146057531 17:29588903-29588925 GCAGCAGGTGCAAGACGCGGGGG + Intronic
1146197242 17:30824346-30824368 GGGGAAGGTGGGAGTTGGGGAGG - Intronic
1146372046 17:32270711-32270733 GCAGCAGGTGGGAGACCTGAGGG + Intronic
1147044533 17:37743294-37743316 GCGGAAGGTGTGAGTCGCGGAGG - Intronic
1147419351 17:40314457-40314479 GGGGCAGGTGGGAGAGTGGGTGG + Intronic
1147582952 17:41637102-41637124 AGCGCAGGTGGGAGAGGGGGAGG + Intergenic
1147910421 17:43852927-43852949 CTGGAAGGTGGGAGAAGGGGAGG - Exonic
1147971253 17:44219947-44219969 GGGGCAGCTGGGAGGAGGGGCGG + Intronic
1148432063 17:47650356-47650378 GAGGAAAGTGGGAGACGGAGCGG - Intronic
1148856858 17:50583667-50583689 GGGGGAGGTGGGAGATGGAGGGG + Intronic
1148908987 17:50930047-50930069 GCAGAAGGTGGGAGGTGGGGAGG - Intergenic
1149332747 17:55603722-55603744 ATGGTAGGTGGGGGACGGGGTGG + Intergenic
1149497773 17:57131184-57131206 GGGGGAGGTGGAAGGCGGGGAGG - Intergenic
1150260427 17:63785522-63785544 GAGGCAGATGTGAGAGGGGGGGG + Intronic
1150373519 17:64661913-64661935 GCGGCACGGGGGCGACGGCGAGG + Exonic
1150608357 17:66713448-66713470 GCTGCAGGTGGGAGTAGGGTGGG - Intronic
1151429192 17:74051123-74051145 TGGGCAGGTGGGAGAAGGGGAGG - Intergenic
1151525003 17:74659071-74659093 GAGGAAGGTGGGACTCGGGGAGG - Intergenic
1151585802 17:75007765-75007787 GCTGCTGGTGCGAGAAGGGGTGG - Intergenic
1151658736 17:75507887-75507909 GGGCCAGCTGGGAGGCGGGGGGG - Intronic
1151829844 17:76543082-76543104 GCGGCAAGAGGGAGAATGGGGGG + Exonic
1152705581 17:81841895-81841917 GTGGCAGGTGGGAGTGGGGGTGG - Intergenic
1152716591 17:81903331-81903353 GCTGAAGGTGGGAGATGGGTAGG + Intronic
1152718585 17:81911517-81911539 GCGGAGGGCGGGAGGCGGGGCGG - Intergenic
1152754368 17:82081019-82081041 ACGTCAGGTGGGAGTCGGGGTGG + Intronic
1152762958 17:82119083-82119105 GCGGGAGGTGGGGGCGGGGGTGG + Intronic
1152840771 17:82566711-82566733 GCAGCAGGTGGGAGGAGAGGCGG - Intronic
1152896642 17:82915123-82915145 GCTACATGTGGGAGACGGGGAGG + Intronic
1153285197 18:3450097-3450119 GGGGCGGGAGGGGGACGGGGCGG + Intronic
1153621369 18:6981358-6981380 GATGCAGGTGGGAGACTGTGAGG - Intronic
1153647254 18:7206324-7206346 GAGGCAGGTGGGAGATGCGGTGG - Intergenic
1153881074 18:9422230-9422252 GGGGCGGGTGGGAGGTGGGGAGG + Intergenic
1153927137 18:9843967-9843989 GGGGCAGGTGGAGGAAGGGGCGG + Intronic
1154250161 18:12737654-12737676 GCGGCCTGTGGGGGACGGGCTGG + Intergenic
1154305898 18:13230655-13230677 GCTGCAGGTGGGGGAAGAGGTGG + Intronic
1154335643 18:13462687-13462709 GCGGAAGGTGGGAGTCCAGGAGG + Intronic
1154416654 18:14179019-14179041 GCTGCAGCTGCGAGAGGGGGCGG - Intergenic
1154492369 18:14931990-14932012 GAGGGAGGTGGGAGGTGGGGTGG - Intergenic
1154953737 18:21234959-21234981 GGGGCAGGTGGCAGCAGGGGTGG + Intergenic
1155064768 18:22258823-22258845 GCGGGGGGTGGGGGAGGGGGTGG - Intergenic
1155337791 18:24783191-24783213 GCAGGAGGAGGGAGACTGGGGGG - Intergenic
1155520852 18:26667628-26667650 GAGGAAGGAGGGAGACAGGGAGG + Intergenic
1155791421 18:29975353-29975375 GCGGCAGGTGAGAGAAGCAGGGG - Intergenic
1156479462 18:37427022-37427044 GCAGCAGCAGGGACACGGGGGGG + Intronic
1158243611 18:55405762-55405784 GAGGCAGGAGGGAGAGGAGGAGG + Intronic
1158413714 18:57231157-57231179 GGGACAGGTGGGAGAGGGGAGGG + Intergenic
1158960947 18:62587334-62587356 GCAGGAGCTGGGAGGCGGGGTGG + Intronic
1159131166 18:64281600-64281622 GCTGCAGGTGGGAGGGGGGCAGG + Intergenic
1160758790 19:772125-772147 GAGGAAGGGGGGAGACAGGGAGG - Intergenic
1160870384 19:1275224-1275246 CTGGCAGCGGGGAGACGGGGCGG - Intergenic
1160979856 19:1811966-1811988 GCGGCTGCGGGAAGACGGGGTGG - Intronic
1160980880 19:1816041-1816063 GAGGCGGGTGGGAGGCGGGCAGG + Exonic
1161169548 19:2805985-2806007 GCGGGGGGTGGGGGACGGGTGGG + Intronic
1161210426 19:3062617-3062639 GCGGCGGGCGGGCCACGGGGAGG - Intronic
1161250415 19:3276795-3276817 GTGTCTGGTGGGAGGCGGGGGGG + Intronic
1161370299 19:3907641-3907663 GAGGGAGGTGGGAGAGGGGAAGG + Intronic
1161492110 19:4567786-4567808 GAGGCAGGTGGGAGCCATGGAGG - Intergenic
1161619180 19:5289482-5289504 GAGGCAGGTGGGAGCCATGGAGG - Intronic
1161623173 19:5309955-5309977 GAGGGAGGTGGGAGCCAGGGAGG - Intronic
1162396456 19:10420446-10420468 GCGGCGGGCGGGGGGCGGGGAGG + Intronic
1162706063 19:12555606-12555628 GCGGCGGGCGGGAAGCGGGGCGG + Intronic
1162802499 19:13118862-13118884 GCGGCCGGAGGGGGGCGGGGAGG + Intronic
1162918754 19:13888338-13888360 GAGGCAGGTGGGAGGGGAGGAGG - Intronic
1162954607 19:14091042-14091064 GCGGCGGGCGGGGGAGGGGGAGG + Intergenic
1163003757 19:14384580-14384602 GCGGCAGGTGGGGCCTGGGGCGG - Intronic
1163034734 19:14564104-14564126 GGGGCAGGTGGGAGGAGGGTAGG + Intronic
1163663478 19:18592204-18592226 GAGGGAGATGGGAAACGGGGCGG + Exonic
1164037365 19:21466656-21466678 GCGGCAGGTGGGGCAAGGAGGGG + Intronic
1164528531 19:29029490-29029512 GTGGAAAGTGGGAGATGGGGTGG + Intergenic
1164827769 19:31297023-31297045 GCGGGAGGTGGGAGGCTGGAAGG + Intronic
1165928345 19:39341402-39341424 GAGGCAGCTGGGGGAGGGGGTGG - Intronic
1166230406 19:41423076-41423098 GCCGCAGCCGGGAGATGGGGTGG - Exonic
1166294866 19:41883998-41884020 GCTGGGGGTGGGAGACGGAGGGG + Intronic
1166611506 19:44203294-44203316 GAGGGAGGGGGGAGAGGGGGAGG - Intergenic
1167114885 19:47483415-47483437 GTGGCAGGAGGGATCCGGGGCGG + Intronic
1167288032 19:48609844-48609866 CCGGGAGGTGGGGGGCGGGGCGG + Intronic
1167467475 19:49657966-49657988 GACGCGGATGGGAGACGGGGAGG + Intronic
1168263770 19:55209916-55209938 GGGGCTTGTGGGAGACGGAGAGG - Intergenic
1168314164 19:55476801-55476823 GCCGCAGGTGAGAGACCGGAGGG + Exonic
1168339314 19:55614473-55614495 GCGGGAGGTGGGGGCCGGGCTGG - Exonic
1168344182 19:55642481-55642503 GCGGCAGCTGGGAGCGGCGGAGG - Exonic
925927617 2:8681739-8681761 GCGGGAGGAGGGAGAGGAGGAGG - Intronic
925927628 2:8681768-8681790 GCGGCGGGCGGGGGGCGGGGAGG - Intronic
926638094 2:15205778-15205800 GCAGCAGGAGAGAGAGGGGGTGG - Intronic
926811138 2:16756413-16756435 GAGGCAGGGAGGAGCCGGGGAGG - Intergenic
927308712 2:21603842-21603864 GCGGCAGATGGGGGGCGGGCTGG - Intergenic
927652369 2:24920258-24920280 GCGGGAGGCGGGAGGCGGGCGGG + Intergenic
927719468 2:25373445-25373467 CCGGAAGGTGGGGGGCGGGGCGG + Intergenic
927902041 2:26827448-26827470 GCGGCAGGTGGCAGACTTAGAGG - Intergenic
928402277 2:30987729-30987751 GCAGCAGGTGGGGGAGGAGGGGG - Intronic
928593923 2:32842919-32842941 GGGGCAGGTGGGTGGCGGGGCGG - Intergenic
929967010 2:46543371-46543393 GGGGCGGGTGGGAGAGGGGGTGG - Intronic
931994303 2:67825005-67825027 GGGGGAGGTCGGAGAGGGGGAGG - Intergenic
932496607 2:72148681-72148703 GCGGGAGGGGTGAGGCGGGGTGG + Intergenic
933658087 2:84905592-84905614 GCGGCGGGTGAGGGGCGGGGCGG + Intronic
933749983 2:85597023-85597045 GTGGCAGTTGGGAGCAGGGGAGG + Intronic
934295439 2:91739260-91739282 GCTGCAGGTGGAAGATGGTGAGG - Intergenic
934715346 2:96539722-96539744 GCAGCAGCGGGGAGAGGGGGAGG - Intronic
935114620 2:100124657-100124679 GCAGAAGGGGGGAGATGGGGGGG + Intronic
935196663 2:100820327-100820349 GCCGCCGCTGGGAGACGAGGCGG - Exonic
935796043 2:106642396-106642418 GGGGAAGGAGGGAGACGGGAAGG - Intergenic
935815734 2:106844208-106844230 GTGGGAGGTGGGGGGCGGGGAGG - Intronic
936938552 2:117860121-117860143 GCGGCAGGTGGAAGGCGCCGCGG - Intergenic
937083514 2:119156775-119156797 GCGGGGGGTGCGAGGCGGGGTGG - Exonic
937779458 2:125820534-125820556 AGGGCAGGTGGGAGAAGGCGAGG + Intergenic
937896043 2:126977352-126977374 GCCGCAGCTGGGTGACAGGGTGG - Intergenic
938071724 2:128311882-128311904 GGGGGAGGTGGCAGAAGGGGTGG + Intronic
938128342 2:128690548-128690570 GGGGTAGGTGGGGAACGGGGTGG - Intergenic
940798614 2:158107580-158107602 GAGGCAGGTGAGAAAAGGGGAGG + Intronic
941773195 2:169364340-169364362 GCGGGAGGAGGGAGGCGGCGAGG + Intergenic
942155307 2:173121738-173121760 GTGGCGGGTGGGCGGCGGGGGGG - Intronic
943051262 2:182916063-182916085 GCAGGAGCAGGGAGACGGGGAGG - Intronic
943064002 2:183068674-183068696 GCTGCAGGAGGGATAGGGGGTGG + Intergenic
944412601 2:199458340-199458362 GGGGCGGGTGGGAGGCAGGGAGG + Intronic
946202805 2:218080758-218080780 GCAGCAGGTGGGAGGGAGGGAGG - Intronic
947534103 2:230930052-230930074 GGCCCAGGTGGGAGGCGGGGGGG - Intronic
947826263 2:233107804-233107826 GCGGGTGGTTGGAGACAGGGTGG + Intronic
948817548 2:240520346-240520368 GCCGCAGGTAGGAGCCGCGGCGG - Exonic
948830980 2:240598156-240598178 GGGGCAGGCAGGAGACGTGGGGG - Intronic
948832305 2:240604016-240604038 CCAGCAGGTGTGAGCCGGGGCGG - Intronic
948857589 2:240737206-240737228 GGGGCAGGTGGGACCCTGGGGGG + Intronic
948963749 2:241360010-241360032 GCAGCTGGAGGGAGACAGGGAGG - Intronic
1168883399 20:1226016-1226038 GCGGCAGGCGCGGGGCGGGGAGG - Intergenic
1169075992 20:2760076-2760098 GAGGCAGGTGAGAGGCCGGGCGG - Exonic
1169132500 20:3173405-3173427 GCGGCAGGTCGGAGCCGGGAGGG + Intronic
1169204076 20:3730387-3730409 GGAGCAGGAGGGAGACGGGAGGG + Intergenic
1169282097 20:4276744-4276766 GTGGGAGGTGGGAGAGGGGCAGG - Intergenic
1171299870 20:24050803-24050825 GGGGCAGGTTGGGGTCGGGGAGG - Intergenic
1171810263 20:29741350-29741372 GCGGGGGGAGGGAGAAGGGGCGG + Intergenic
1171908711 20:30921821-30921843 GCGGGGGGAGGGAGAAGGGGCGG - Intergenic
1172277182 20:33686112-33686134 GGGGCCGGTGGGAGCCGGCGGGG + Exonic
1173772204 20:45670496-45670518 GGGGCAGGGGGGAGGGGGGGTGG - Intergenic
1174295432 20:49542136-49542158 GAGGTAGGTGGGAGGAGGGGAGG + Intronic
1175465964 20:59191531-59191553 GCCGCAGGTGGCACACGGGAAGG - Exonic
1175851814 20:62097771-62097793 GGTGCAGGTGGGAGAGGGTGTGG + Intergenic
1175923005 20:62458795-62458817 GGGGGAGGAGGAAGACGGGGTGG - Intergenic
1175976871 20:62715280-62715302 GAGCCAGGTGGGAGACGGCAGGG + Intronic
1176051108 20:63120192-63120214 GGGGCAGCTGGGAGCCTGGGAGG - Intergenic
1176408995 21:6437583-6437605 GAGGCAGGTGGGAGGAGGAGAGG - Intergenic
1176856681 21:13980241-13980263 GCTGCAGCTGCGAGAGGGGGCGG + Intergenic
1177725647 21:24963522-24963544 GGGACTAGTGGGAGACGGGGAGG - Intergenic
1177775501 21:25562032-25562054 GCAGGAGGGGGGAGAAGGGGGGG + Intergenic
1178479931 21:32971146-32971168 GGGGCGGGGGGGAGAGGGGGAGG - Intergenic
1178525505 21:33325125-33325147 GCCGCAGGTGAGAGGCGGGGAGG + Exonic
1178694575 21:34781780-34781802 GCTGCAGGTGGGAGTGGCGGAGG - Intergenic
1178811162 21:35882780-35882802 GCGGCATCTGGGAGCCAGGGTGG - Intronic
1178824673 21:36005042-36005064 GGGGGAGGGGGGAGTCGGGGGGG + Intergenic
1179684488 21:43045905-43045927 GAGGCAGGTGGGAGGAGGAGAGG - Intergenic
1179982917 21:44905792-44905814 GAGGCAGCTGGGAGACAGTGAGG - Intronic
1180081547 21:45489894-45489916 GGGGCAGGTGGAAGTGGGGGAGG - Intronic
1180110325 21:45644275-45644297 GCGGCTGGAGGGCGGCGGGGCGG + Intronic
1180149821 21:45941724-45941746 CTGGCAGGTGGGTGACGCGGGGG - Exonic
1180970027 22:19810443-19810465 GCTGCAGGAGGGAGCGGGGGTGG + Intronic
1180989067 22:19923197-19923219 TGGGCATGTGGGAGAGGGGGTGG - Intronic
1181283438 22:21735896-21735918 GGGGCAGGCGGGACGCGGGGCGG - Intergenic
1181435870 22:22910496-22910518 GCTTCAGGTGGGGGATGGGGAGG + Intergenic
1181750993 22:24989226-24989248 CCTCCAGGTGGGAGACGGGGTGG - Intronic
1182134830 22:27891678-27891700 GCGGCAGGAGAGAGAGGAGGAGG - Intronic
1182145419 22:27994154-27994176 GCGGCAGCTGAGAGGCGTGGTGG + Intronic
1182302732 22:29346780-29346802 GAGGCAGGTGGCAGTGGGGGGGG + Intronic
1182312077 22:29416344-29416366 GCTGCAGGTGGGGGCTGGGGAGG + Intronic
1182548443 22:31088831-31088853 GTGGCAGGTGAGTGACAGGGAGG - Intronic
1182688183 22:32136899-32136921 GCTGCAGGTGGGGGCTGGGGAGG - Intergenic
1183098278 22:35567705-35567727 GTGCCAGGTGGGACAAGGGGAGG + Intergenic
1183230605 22:36579676-36579698 AAGGCAGGTGGCAGAAGGGGTGG - Intronic
1183428134 22:37750539-37750561 GTCTCAGGTGGAAGACGGGGTGG + Intronic
1183744673 22:39685735-39685757 GGGGGAGGTGGGAGCCGTGGAGG - Intronic
1184177372 22:42795896-42795918 GGGGCAGGGGGGAGACCGAGGGG + Intergenic
1184250491 22:43257553-43257575 GTGACAGGTGAGAGACGGGCTGG + Intronic
1184370298 22:44077623-44077645 TCGCCAGGTGGGTGCCGGGGAGG + Intronic
1184376479 22:44116937-44116959 GGGGCAAGAGGGAGATGGGGAGG + Intronic
1184472357 22:44702855-44702877 CCGGCGGGTGGGCGGCGGGGTGG + Intronic
1184583288 22:45431087-45431109 GGGCCAGGTGGGGGACCGGGTGG + Intronic
1184648823 22:45910382-45910404 GTGGCAGCTGGGAGACACGGTGG + Intergenic
1185100336 22:48836879-48836901 GCGGCAGGTGGGAAGGGCGGGGG + Intronic
1185345189 22:50307776-50307798 GGGGGAGGGGGGAGAGGGGGAGG + Intergenic
1185345198 22:50307791-50307813 GGGGGAGGGGGGAGAGGGGGAGG + Intergenic
1185375503 22:50481220-50481242 TCGGGAGGTGGTTGACGGGGTGG + Intergenic
949898017 3:8784684-8784706 CAGGCAGGTGGGAGAGGGGGTGG + Intronic
950536346 3:13581207-13581229 GCGGCAGGTGGGGGGTGGGGGGG + Intronic
952255297 3:31689973-31689995 GAGGAAGGTGGGAGGAGGGGAGG + Intronic
952858775 3:37794991-37795013 GAGGGAGGAGGGAGACAGGGTGG - Intronic
952882678 3:37994485-37994507 GGGGCAGGAGGGAGCCGTGGAGG + Intronic
952898114 3:38092718-38092740 GAGGAGGGTGGGAGGCGGGGAGG + Intronic
953030645 3:39177745-39177767 GCGGGAGGCGGGAGGCGGGAAGG - Intergenic
953084709 3:39655259-39655281 GCGGGAGGAGGGAGAGGGAGAGG - Intergenic
953879252 3:46683216-46683238 GCGGCAGTCGGGAGGCTGGGAGG + Exonic
953932074 3:47010407-47010429 GAGACAGGTGGGAGGCGGGAGGG + Intergenic
954665473 3:52249119-52249141 GAGGCTGGTGGGAGTCGGGAAGG + Intronic
954707140 3:52487131-52487153 GTGGCAGGTGGGAGGTGGGAGGG + Intronic
957085107 3:75670604-75670626 GAGGCTGGTGGGACACGGGTTGG - Intergenic
957729311 3:84112181-84112203 GTGGGGGGTGGGGGACGGGGTGG - Intergenic
959817839 3:110696377-110696399 GTGGCAGGTGAGAGAGGGGTAGG - Intergenic
959894820 3:111593965-111593987 GCGGCAGGTGGCATACTGGTTGG + Exonic
961160684 3:124722174-124722196 ACGGCAGGTGGGGGACAAGGAGG + Intronic
961331883 3:126147357-126147379 GCAGCAGGCTGGAGACAGGGTGG + Intronic
961371377 3:126433932-126433954 GAGGCAGCTGGGAGAGGGGCTGG + Intronic
961458978 3:127038328-127038350 GAGGCTGGTGGGAGACAGGTGGG - Intergenic
961549190 3:127658102-127658124 GCAGTAGGTGGAAGAGGGGGAGG + Intronic
961658908 3:128458023-128458045 GCTGGAGGTGGGAGGCAGGGTGG + Intergenic
962024745 3:131536085-131536107 ATGGCAGGTGGGGGACGAGGGGG + Intronic
964118555 3:153160706-153160728 GCGGCGGGTGCGGGATGGGGAGG - Intergenic
964358593 3:155871400-155871422 AGGGCAGGCGGGAAACGGGGTGG - Intronic
964607574 3:158573386-158573408 GCGGGAGGAGGGCGGCGGGGGGG + Intronic
966448924 3:180036387-180036409 TCCGAAGGTGGGAGAAGGGGAGG - Intronic
967131175 3:186471970-186471992 GCAGCAGGTGGCACATGGGGAGG - Intergenic
967204056 3:187103432-187103454 GTGGCGGGTGGGGCACGGGGAGG - Intergenic
967386127 3:188912736-188912758 GGGGCAGGAGGGAGAGAGGGGGG + Intergenic
967885105 3:194328413-194328435 CCGGGAGGTGGGAGATGGGGTGG - Intergenic
968135033 3:196214982-196215004 AGGGCAGGAGGGAGCCGGGGGGG - Intronic
968524411 4:1048682-1048704 GCGGCAGGTGAGAGGCTGAGGGG - Intergenic
968581459 4:1397246-1397268 GCGTCAGCTGGGAGGCGGGGAGG - Intergenic
968674724 4:1871363-1871385 GCGGCGGGCGGGAGGCGCGGGGG + Intergenic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
968985494 4:3872332-3872354 GCTGCACGTGGGAGAAGGGCTGG + Intergenic
969684897 4:8665928-8665950 GGAGCAGGTGGGAGGAGGGGTGG - Intergenic
970266160 4:14288995-14289017 GTGGCAGGTGGGGGGGGGGGGGG - Intergenic
970615869 4:17767698-17767720 GCGGGGGGTGGGGGGCGGGGAGG - Intronic
972543233 4:40057037-40057059 GCGGCGGGTGGGAGGCAGGGAGG + Intronic
973263176 4:48185792-48185814 GAGGGAGATGGGAGAGGGGGAGG - Intronic
973263188 4:48185817-48185839 GAGGGAGATGGGAGAGGGGGAGG - Intronic
974047254 4:56908270-56908292 GCGGCAGTGGCGGGACGGGGAGG + Intronic
976199164 4:82562029-82562051 GCGGCAGGAGGGGGCCGGGCGGG - Intronic
976623789 4:87156397-87156419 GAGGCAGGTGGGGGTCGTGGGGG + Intergenic
977566596 4:98587000-98587022 CCGGCAGTTGGGAGGCAGGGTGG + Intronic
977908296 4:102501676-102501698 GCGGCAGGCCGGAGCCCGGGCGG - Exonic
978603394 4:110451656-110451678 GGTGAAGGTGGGAGAAGGGGAGG + Intronic
978699122 4:111621787-111621809 GTGGCAGGTGAGAGAGAGGGTGG + Intergenic
978759739 4:112343746-112343768 GGGGTAGGGGGGAGAAGGGGGGG - Intronic
980930223 4:139177275-139177297 GCGGCAGGAGGCCGAGGGGGAGG - Intergenic
981447248 4:144854289-144854311 CCGTCAGGTGGGAGAGGGAGGGG + Intergenic
981568858 4:146130997-146131019 GCGGCAGGTGGCAGAATGGCAGG + Intergenic
981700924 4:147606426-147606448 AAGGCAGGTGGGAGAGGAGGAGG + Intergenic
982033619 4:151325225-151325247 GCCGCAGGTGAGAGGCGCGGGGG - Intronic
983872481 4:172838133-172838155 GGGGCAGTTGAGAGATGGGGGGG + Intronic
984206478 4:176792800-176792822 GCGGGAGGAGGGCGGCGGGGCGG + Intergenic
984734811 4:183099192-183099214 GCGGCCAGAGGGGGACGGGGCGG + Intergenic
984944331 4:184959514-184959536 GCTGCAGGTGGGAGGCAGTGGGG - Intergenic
985447473 4:190032919-190032941 GTGGCAGGTGGGACCTGGGGAGG - Intergenic
985551107 5:534114-534136 GGGACAGGAGGGAGCCGGGGGGG - Intergenic
985696715 5:1345022-1345044 GCGCCAGGTGGGAGCGGGGCCGG - Exonic
985783106 5:1881159-1881181 GGGGCAGCTGGGAGAAGGAGTGG + Intronic
986311371 5:6553364-6553386 GTCGAGGGTGGGAGACGGGGAGG + Intergenic
986600473 5:9467719-9467741 CCTGGAGGTGGGAGCCGGGGTGG + Intronic
987373937 5:17217520-17217542 GCGGGAGGAGGGAGGCTGGGCGG + Intronic
988605222 5:32673445-32673467 GGTGCGGGTGGGAGCCGGGGCGG - Intergenic
988623960 5:32851281-32851303 GCGGCAGGAGGGTGAGGGTGAGG + Intergenic
988629933 5:32918011-32918033 GTGGCAGGAGGGAGACGGTTGGG - Intergenic
989753954 5:44928878-44928900 GCGGAAGGAGGGAGAAGGGGAGG - Intergenic
993030426 5:82699434-82699456 GCCTCAGGTGGGAGGCTGGGAGG + Intergenic
993426019 5:87765014-87765036 GGGGGAGGTGGGGGACTGGGGGG + Intergenic
994366919 5:98928174-98928196 GCGGCGGGAGGGGGAGGGGGCGG - Intronic
995803489 5:116025141-116025163 CCGGCAGGTGTGAGAAGGGAAGG + Intronic
997361720 5:133299470-133299492 CTGGCAGGTGGGAGGCAGGGAGG + Intronic
997585451 5:135040533-135040555 GCTGCCGCTGGGAGACGGGCTGG + Intronic
997835023 5:137185142-137185164 GGGTCAGTTGGGAGAGGGGGAGG + Intronic
997882791 5:137605160-137605182 GCAGCAGGTGGGGGGCGTGGAGG + Intergenic
998022059 5:138777915-138777937 GGGGGAGGAGGGAGAGGGGGAGG + Intronic
998022066 5:138777930-138777952 GGGGGAGGAGGGAGAGGGGGAGG + Intronic
998022073 5:138777945-138777967 GGGGGAGGAGGGAGAGGGGGAGG + Intronic
998391488 5:141789636-141789658 GAGGCAGGAGAGAGGCGGGGTGG + Intergenic
999257970 5:150220347-150220369 GGGGCAGGTGGGGGAGGGGATGG + Intronic
1000171619 5:158708004-158708026 GGTGCAGGTGGGAGGTGGGGAGG + Exonic
1001332660 5:170773182-170773204 GTGGCAGGGGGGTGAGGGGGTGG + Intronic
1001577031 5:172771227-172771249 GCGGCCTCTGGGGGACGGGGCGG + Intergenic
1002042089 5:176521805-176521827 GCGGGAGCTGGGAGCCGGTGAGG - Intergenic
1002131954 5:177087190-177087212 GCGGCAGGGGGTGGAGGGGGCGG + Intronic
1002193548 5:177490832-177490854 GCAGGAGGTGGGAGAGGGGCTGG + Intronic
1002415072 5:179116117-179116139 GGTGGAGGTGGGAGACGGGGAGG - Intronic
1002579490 5:180199068-180199090 GTGGCAGGTGGGGGTTGGGGAGG - Intronic
1003815707 6:9837773-9837795 GCGGCAGGAGGGAGAAGATGAGG + Intronic
1004590510 6:17047045-17047067 TAGGCAGGTGGGTGACGGTGAGG + Intergenic
1005582966 6:27251133-27251155 GCAGCAGGTGCGGGACGGGGAGG + Intronic
1006187717 6:32190193-32190215 GAGGGAGGAGGGAGAAGGGGGGG + Intergenic
1006256779 6:32838495-32838517 GCGGCAGGCGGGGGTGGGGGTGG - Intronic
1006317378 6:33298648-33298670 GCGCCTGGGGAGAGACGGGGTGG + Exonic
1006385866 6:33730617-33730639 CCAGCAGGTGGAAGACAGGGTGG - Intronic
1006604889 6:35249067-35249089 GGGTCTGGTGGGAAACGGGGAGG + Exonic
1007293097 6:40801816-40801838 GTGGCAGGAGGGAGACTGGGAGG + Intergenic
1007615790 6:43179281-43179303 GCCGCAGGAGGGAGGCGGGGAGG + Exonic
1007777814 6:44233559-44233581 GGGGCAGGAGGCAGACAGGGAGG - Exonic
1008276600 6:49550602-49550624 CCGCCAGGTGGGAGAGGCGGAGG + Intergenic
1009333581 6:62457144-62457166 GGGGCATGTGGGAAAAGGGGAGG - Intergenic
1009959804 6:70504874-70504896 GAGGCAGGTGGTAGAGGTGGAGG + Intronic
1011410196 6:87059666-87059688 GAGGCAGGGGGGAGGTGGGGAGG + Intergenic
1011410231 6:87059738-87059760 GGGGGAGGTGGGGGAGGGGGAGG + Intergenic
1011427008 6:87240368-87240390 GCGGTGGGTGGGGGAGGGGGAGG + Intronic
1011474478 6:87737454-87737476 GGGGCAGGTGGGAGAGTGAGGGG - Intergenic
1011534437 6:88360802-88360824 GAGGCAGGTGGGAGACAGGGAGG - Intergenic
1011662561 6:89606856-89606878 GGGGCAGGTGGGGGCGGGGGTGG + Intronic
1012401903 6:98848195-98848217 GCGGCAAGAGGGAGGCCGGGAGG - Intergenic
1013099451 6:106974802-106974824 GCGGCGGAGGGGAGCCGGGGTGG - Intronic
1013873447 6:114796007-114796029 GCTTCAGGTGGGAGACGGCTTGG + Intergenic
1013900370 6:115148501-115148523 GTGGCAGGAGGGAGAAAGGGAGG + Intergenic
1015327599 6:131941090-131941112 GCGGGTGGTGGGGGAAGGGGAGG + Intergenic
1015328825 6:131953456-131953478 GAGGTAGGTGGGAGAAGGGTTGG + Intergenic
1015910119 6:138161675-138161697 GCGGCGGGAGGCAGGCGGGGAGG - Intergenic
1016330040 6:142945782-142945804 GCGGCCGGCGGGAGGCGGGCTGG - Intergenic
1016497603 6:144682125-144682147 GGGGCAGGGGGGTGATGGGGAGG - Intronic
1016993439 6:149944923-149944945 GCGGGAGGTGGGAGAGGGTGTGG - Intronic
1016998373 6:149977093-149977115 GCAGGAGGTGGGAGAGGGTGTGG - Intergenic
1017001732 6:150002023-150002045 GCAGGAGGTGGGAGAGGGTGTGG + Intergenic
1017004894 6:150022607-150022629 GCGGGAGGTGGGAGAGGGTGTGG + Intronic
1017006599 6:150032082-150032104 GCAGGAGGTGGGAGAGGGGAGGG - Intergenic
1017662315 6:156687039-156687061 GTGGAAGGTGGGAGGTGGGGCGG - Intergenic
1017842429 6:158232440-158232462 GCGGCGGGCGGGGGTCGGGGCGG + Intronic
1017996398 6:159534982-159535004 GTGGCAGGAGAGAGACGGGTAGG + Intergenic
1018956700 6:168415237-168415259 ACGGCAGCATGGAGACGGGGGGG + Intergenic
1019493613 7:1326176-1326198 GCGGCAGCTGGGAGTTGGGGCGG + Intergenic
1020087667 7:5320284-5320306 GCGGCAGGGGAGAGCTGGGGAGG + Intronic
1020119379 7:5494627-5494649 CCGGAAGGTGGGAAACGGGAAGG + Intronic
1021451342 7:20785706-20785728 GAGGGAGGAGGGAGACGGGCTGG + Exonic
1021852101 7:24818147-24818169 GGGGCAGGTGGCAGAGGGGGTGG + Intronic
1022094640 7:27130939-27130961 GCTGCACGTGGGGCACGGGGCGG - Intronic
1023875825 7:44285807-44285829 GCGGCGGGGGGGAGGCGCGGCGG + Intronic
1024509300 7:50190598-50190620 GCAGCAGGTGGTAGATGAGGAGG - Intergenic
1024948260 7:54833462-54833484 GCGGCAGGTGGGATGGAGGGGGG + Intergenic
1025069806 7:55887908-55887930 GCGGCAGGTGGCGGGAGGGGCGG + Intronic
1027043210 7:74974460-74974482 GGGGCAGGGGGGAGTCTGGGAGG + Intronic
1027358600 7:77384841-77384863 GAGGCAGGAGGGAGAAGGCGGGG + Intronic
1028107212 7:86892983-86893005 GCTGAAGGTGGGAGCCGGTGTGG - Exonic
1028595859 7:92545877-92545899 GCGGGAGACGGGAGACGGAGAGG + Intergenic
1029211291 7:98910233-98910255 GTGGCAGGTGGGGGTGGGGGCGG - Exonic
1029400473 7:100342287-100342309 GGGGCAGGTGGGGGAGGGGAGGG - Intronic
1029419280 7:100464084-100464106 GTGGCGGGTGGGGGATGGGGTGG + Exonic
1029480008 7:100806636-100806658 GAGGCAGGTGGGGGACTGGGGGG - Intronic
1029973945 7:104815242-104815264 GCTGCAGCAGGGAGGCGGGGTGG - Intronic
1030208649 7:106975071-106975093 GCTGCTGGTGGGAGCAGGGGAGG - Intergenic
1032066935 7:128778902-128778924 GCCGCAGGTGGGAGTCCTGGTGG + Intergenic
1032075518 7:128833982-128834004 GGGGCAGGTGGGAGTGGGGCAGG + Intronic
1032351803 7:131171369-131171391 TTGGCAGGTGGGAGAGGGGAAGG + Intronic
1032848233 7:135770143-135770165 GCTGCAGGAGAGAGACGGCGTGG + Intergenic
1033769054 7:144527950-144527972 GAGGCGGGTGGGAGGCGGGTGGG + Intronic
1034278447 7:149834942-149834964 GTGGCAGGTGGGAGTCAGGGAGG - Intergenic
1034970774 7:155417945-155417967 ACGGCAGGTGGGAGGAGTGGGGG - Intergenic
1035019854 7:155794467-155794489 GAGGCAGCTGTGAGATGGGGAGG - Intergenic
1035159879 7:156942867-156942889 GCGGCAGGCGTGAGGCTGGGCGG + Intergenic
1035639793 8:1176193-1176215 GCGGTAGGTGAGAGACAGTGTGG + Intergenic
1035747742 8:1974074-1974096 CCGGCAGGGGAGAGGCGGGGAGG + Intronic
1036559590 8:9890281-9890303 GAGGCAGGTGGGATCTGGGGTGG - Intergenic
1037674679 8:21043217-21043239 GTGGAAGGTGGGAGGTGGGGTGG - Intergenic
1037711068 8:21355878-21355900 GGGGCAGGTGGGACCTGGGGTGG - Intergenic
1037805166 8:22054853-22054875 GCGGCAGCAGGGAGGGGGGGAGG - Intronic
1037828873 8:22176852-22176874 GCGGCAGGGGAGCGAAGGGGAGG - Intronic
1038278769 8:26143731-26143753 ACGGTAGGTGGGAGAGAGGGGGG - Intergenic
1039246560 8:35615043-35615065 TCGGGGGGTGGGGGACGGGGGGG - Intronic
1040080071 8:43276102-43276124 GCGGCATGTGGGAGCCGGCAGGG + Intergenic
1043383056 8:79723308-79723330 GCTGCAGGTGGGAGATTGCGTGG + Intergenic
1044654599 8:94534588-94534610 GAGGCAAGAGGGAGAAGGGGAGG - Intronic
1044933405 8:97271331-97271353 ATGGCAGGTGGGTGGCGGGGTGG + Intergenic
1045208684 8:100071424-100071446 GCAGGAGGTGGTAGACTGGGTGG + Exonic
1045235633 8:100350767-100350789 GTGGAAAGTGGGAGACGAGGTGG - Intronic
1045305456 8:100952816-100952838 GCGGCGGGAGGGAGGCCGGGAGG - Intronic
1045582824 8:103499490-103499512 GCTGAAGGTGGGTGACAGGGAGG - Intergenic
1047927636 8:129696992-129697014 GAGGGAGGTGGGAGAGAGGGAGG + Intergenic
1048006331 8:130422222-130422244 GCTGCAGGTGGAGGAAGGGGAGG + Intronic
1048912848 8:139152647-139152669 GGGGCATGTTGGAGAAGGGGTGG + Intergenic
1049041904 8:140118867-140118889 GCCGCAGGTGGGACCCGGGCTGG - Intronic
1049363226 8:142224202-142224224 GTGGCTGGTGGGAAAAGGGGAGG + Intronic
1049536061 8:143183089-143183111 CCAGGAGGTGGGAGATGGGGAGG - Intergenic
1049639355 8:143707627-143707649 GCGGCCGGGGTGAGGCGGGGCGG - Intronic
1049643301 8:143725141-143725163 GGGGGAGGGGGGAGACGGGGGGG + Exonic
1049791088 8:144473045-144473067 GCTGCAGGTGGGCGCCGGGGCGG + Exonic
1050862172 9:10449048-10449070 GTGGAAAGTGGGAGACGGAGAGG - Intronic
1051361161 9:16282876-16282898 GCAGGAGGTGGAAGACGGGAGGG + Intergenic
1051366715 9:16326576-16326598 AGGGCAGGTGGGAGAGGTGGGGG - Intergenic
1051403120 9:16705139-16705161 GCGGCCGGTGGGGGTGGGGGTGG - Intronic
1052056286 9:23911164-23911186 GCTGCTGGTGGGAGGTGGGGAGG - Intergenic
1053142582 9:35690668-35690690 GGGGCACGTGGGGGGCGGGGCGG - Exonic
1053840064 9:42183501-42183523 GCAGCAGGAGGGGGAGGGGGAGG - Intergenic
1056985670 9:91361931-91361953 GCGGCAGGTCGGCGCCGGGCGGG - Intergenic
1057142753 9:92737498-92737520 GCAGCGCGTGGGAGACTGGGTGG + Intronic
1057219248 9:93247219-93247241 GGGGCTGGTGGCAGACGGGAAGG - Intronic
1058058816 9:100474150-100474172 GCGGTGGGTGGGAGACGGCGAGG + Intronic
1058163515 9:101595082-101595104 GCGGCAGGTCAGAGAGGGAGCGG + Intronic
1059392405 9:114007510-114007532 GAGGGAGGAGGGAGGCGGGGAGG - Intronic
1059570643 9:115430824-115430846 GTGGCAGGTGGGAGACATTGGGG - Intergenic
1060109641 9:120897316-120897338 GAGGCAGATGGGAGTCAGGGAGG + Intergenic
1060157106 9:121327476-121327498 GAGCCAGGTAGGAGCCGGGGTGG + Exonic
1060811676 9:126614082-126614104 GCGGCAGGCGGGGGAGGGGGTGG - Intergenic
1061248422 9:129413384-129413406 GCGGCGGGCGGGGGCCGGGGCGG - Intergenic
1061315915 9:129795716-129795738 GAGGCAGGAGAGAGAAGGGGCGG + Intergenic
1061334627 9:129923974-129923996 GAGGCAGGAGGGGGAGGGGGAGG + Exonic
1061887365 9:133598588-133598610 GCTGCTGGTGGGAGAGAGGGAGG + Intergenic
1061961930 9:133992885-133992907 GCGGCGCTTGGGACACGGGGAGG - Intergenic
1062008853 9:134256319-134256341 CCTGCAGGTGGGAGTCGGGGAGG + Intergenic
1062327815 9:136020544-136020566 GGGGTAGGAGGGAGACGGGGAGG + Intronic
1062450640 9:136614366-136614388 GGGGAAGGCGGGAGCCGGGGCGG - Intergenic
1062596626 9:137302572-137302594 GTGGCCGGAGGGAGAAGGGGCGG - Intergenic
1062618296 9:137407826-137407848 GCGGGAGGCGGGAGGCGGGAGGG + Intronic
1062621382 9:137423828-137423850 CCGGCAGGTGGGAGCCGAGCAGG + Intronic
1185608520 X:1380624-1380646 GGGGAAGGAGGGAGAGGGGGAGG + Intronic
1186170916 X:6875577-6875599 GCCACAGGTGGGAGACTAGGAGG + Intergenic
1186788764 X:12976405-12976427 GCGGCCGGTGGGAGGGCGGGAGG + Intronic
1186872530 X:13786568-13786590 GGGGCAGGTGGAAGCCGGGGAGG - Intronic
1190096581 X:47486069-47486091 GCGGGGGGTGGGGGACGGGTTGG - Intergenic
1190109724 X:47582258-47582280 GAGGCGGGTGGGAGAGGAGGAGG + Intronic
1190789730 X:53687048-53687070 GCGGAGGGTGGGAGACGACGTGG + Intergenic
1191828524 X:65391732-65391754 GCGGGAGGAGGGAGAGGGAGAGG - Intronic
1192251436 X:69417036-69417058 GCGGGGGGGGGGAGAGGGGGCGG - Intergenic
1192796947 X:74431878-74431900 TGGGAAGGTGGGAGATGGGGAGG - Intronic
1194478272 X:94388093-94388115 GAGGCAGGTGGGGGAAGTGGAGG + Intergenic
1195264227 X:103164382-103164404 GGGGCAGGTGTGAGACTGGAAGG + Intergenic
1196031561 X:111098913-111098935 CCGGCAGGTGGGGGTGGGGGTGG - Intronic
1197837822 X:130713954-130713976 GCTGCTGGTGGGGGAGGGGGTGG + Intronic
1197855076 X:130905630-130905652 GTGGAAAGTGAGAGACGGGGAGG + Intergenic
1198254734 X:134914999-134915021 GCGGCGGGGAGGAGACGGAGGGG - Intronic
1198479880 X:137031437-137031459 GCAGCAGGTCGGTGACGAGGAGG + Exonic
1198510021 X:137341080-137341102 GCAGGAGGTGGGAGAGGGTGAGG + Intergenic
1199635453 X:149808156-149808178 GCAGCAGCTGGGCGATGGGGAGG - Intergenic
1200224412 X:154409297-154409319 GCGGCGAGGCGGAGACGGGGCGG - Intronic
1201438507 Y:13985212-13985234 GTGTCAGGAGGGAGACAGGGGGG - Intergenic
1201446066 Y:14057496-14057518 GTGTCAGGAGGGAGACAGGGGGG + Intergenic
1201651660 Y:16295157-16295179 GCAGCACCTGGGAGAAGGGGTGG + Intergenic