ID: 1063371428

View in Genome Browser
Species Human (GRCh38)
Location 10:5525214-5525236
Sequence CCCGCAGCTCGGCCTCCGTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 142}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063371428_1063371434 1 Left 1063371428 10:5525214-5525236 CCCCACGGAGGCCGAGCTGCGGG 0: 1
1: 0
2: 2
3: 10
4: 142
Right 1063371434 10:5525238-5525260 CATGATGAGTGAGATCGACCGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1063371428_1063371435 5 Left 1063371428 10:5525214-5525236 CCCCACGGAGGCCGAGCTGCGGG 0: 1
1: 0
2: 2
3: 10
4: 142
Right 1063371435 10:5525242-5525264 ATGAGTGAGATCGACCGGGACGG 0: 1
1: 0
2: 0
3: 4
4: 51
1063371428_1063371438 19 Left 1063371428 10:5525214-5525236 CCCCACGGAGGCCGAGCTGCGGG 0: 1
1: 0
2: 2
3: 10
4: 142
Right 1063371438 10:5525256-5525278 CCGGGACGGCAACGGCACCGTGG 0: 1
1: 0
2: 0
3: 4
4: 75
1063371428_1063371436 11 Left 1063371428 10:5525214-5525236 CCCCACGGAGGCCGAGCTGCGGG 0: 1
1: 0
2: 2
3: 10
4: 142
Right 1063371436 10:5525248-5525270 GAGATCGACCGGGACGGCAACGG 0: 1
1: 0
2: 0
3: 0
4: 22
1063371428_1063371433 0 Left 1063371428 10:5525214-5525236 CCCCACGGAGGCCGAGCTGCGGG 0: 1
1: 0
2: 2
3: 10
4: 142
Right 1063371433 10:5525237-5525259 ACATGATGAGTGAGATCGACCGG 0: 1
1: 0
2: 0
3: 2
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063371428 Original CRISPR CCCGCAGCTCGGCCTCCGTG GGG (reversed) Exonic
900145602 1:1157611-1157633 CCAGCAGCTCCGCCTCCTCGGGG - Intergenic
900511277 1:3062246-3062268 CCCACAGCACGGCACCCGTGAGG + Intergenic
901128935 1:6950108-6950130 ACCTCTGCTCAGCCTCCGTGAGG - Intronic
901233859 1:7656985-7657007 CCTGCAGCGCGGCCTGTGTGAGG - Intronic
901616239 1:10541867-10541889 CCCTCAGCTCAGCCTTCTTGGGG - Intronic
902923174 1:19679317-19679339 GCCGCAGCTCGGGCTCCGCGGGG - Exonic
903628249 1:24746032-24746054 GCCGCAGTTCGGGCTCCGGGCGG - Intronic
903942500 1:26941522-26941544 CCCGCCGCTCGGCCTCCTGCCGG - Exonic
912315101 1:108661150-108661172 CCCGCGCCTCGGCCTCCCCGCGG + Intronic
915549772 1:156625275-156625297 CCCGCAGCGCGGCCTCGGCGTGG - Exonic
919926164 1:202192968-202192990 CCTGCAGCTCAGCCACCCTGAGG - Intergenic
1063371428 10:5525214-5525236 CCCGCAGCTCGGCCTCCGTGGGG - Exonic
1063382096 10:5591872-5591894 CCCCCAGCCCAGCCTCTGTGTGG + Intergenic
1073329505 10:102661262-102661284 CCCGCAGCGAGGCCACCGCGAGG + Intergenic
1075032078 10:119030212-119030234 CCAGCAGCCCGGCCTCGGCGGGG - Exonic
1076369379 10:129941728-129941750 CCCCAAGCTCTGCCTCCTTGAGG - Intronic
1078180040 11:9003881-9003903 CCCGCATGTCGGTCTCCTTGCGG + Exonic
1079444237 11:20545372-20545394 CAGGCAGCTGGGCCTCTGTGTGG + Intergenic
1083682833 11:64359192-64359214 CGCGCGGCTCGGGCTCCGGGCGG - Exonic
1089561634 11:119346144-119346166 CCCGCAGGTCGGCGTCCTCGAGG - Exonic
1090363124 11:126186954-126186976 CCTGCAGCTGGGGCTCTGTGGGG - Intergenic
1091718556 12:2795945-2795967 CCCGCAGCCCTGGCTCCGGGAGG - Intronic
1094375382 12:29783683-29783705 CCCGCAGCCCCGCCGCCGGGAGG + Exonic
1096529789 12:52235310-52235332 TCCGCAGCTCCGCCTCCAGGCGG - Exonic
1102289350 12:111686125-111686147 CCTGCAGCTCAGCCTAAGTGTGG - Exonic
1104937783 12:132375772-132375794 CCCCCAGCTCTGCCTGCCTGAGG + Intergenic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1110725373 13:78816838-78816860 CCTGCAGCTGGGCCTCCCTGTGG - Intergenic
1122643985 14:103179405-103179427 CCCCCAGCTCTGGCTCAGTGTGG - Intergenic
1124892139 15:33743201-33743223 CCACCAGCTCAGCCTCTGTGTGG + Intronic
1129116382 15:73367649-73367671 GGCGCACCTCGGCCTCCGGGAGG + Exonic
1133001121 16:2852279-2852301 CCCGCAGCTCTGCCATCCTGAGG + Intergenic
1133020577 16:2965089-2965111 CCCGAAGCGGGGCCTCCGTGCGG + Intronic
1133149013 16:3812568-3812590 CCCTCAGCTATGCTTCCGTGAGG + Intronic
1133596669 16:7300275-7300297 CCCCCAGGTCGGCATCAGTGGGG - Intronic
1136146606 16:28320069-28320091 CCCGCAGGTGGGGCTCCCTGAGG + Exonic
1136482620 16:30552065-30552087 CCCTCAGCACAGCCTCCGGGAGG - Intronic
1137581592 16:49636853-49636875 CCTGCAGGTCAGCCTCCTTGCGG + Exonic
1141721158 16:85756061-85756083 CCCACAGCTCTGCCTCCCTTAGG + Intergenic
1141986341 16:87582745-87582767 CCCGCAGCCTGGCCTCGGAGGGG - Intergenic
1144954086 17:19010438-19010460 CCCCCAGCTCTGCCTCCCCGGGG + Intronic
1147159609 17:38562539-38562561 CCCTCAGCTCAGCTACCGTGAGG + Intronic
1150221217 17:63496918-63496940 CATGCAGCTCGTTCTCCGTGCGG - Exonic
1151319348 17:73343257-73343279 CCCGCAGCGCGGGCTCTGTTTGG - Intronic
1152364117 17:79845108-79845130 GCAGCAGCCCGGCCGCCGTGGGG - Intergenic
1152391641 17:80007251-80007273 CCCCCAGCACGGTCTCCGGGTGG + Intronic
1153015728 18:580816-580838 CCTGCAGCTCCTCATCCGTGAGG - Exonic
1154046466 18:10910336-10910358 CGCCCAGCTCGGCCTCCCAGAGG - Intronic
1154323264 18:13371229-13371251 CCCCCATCTCAGCCTCTGTGTGG - Intronic
1161011521 19:1961511-1961533 CCAGGAGCTGGGCCTCAGTGGGG + Intronic
1161129306 19:2578895-2578917 CCCACAGCTCGGCCCCTGGGGGG - Intronic
1161669003 19:5594162-5594184 CCCGCTGCTCGCGCTCCCTGCGG + Exonic
1161850663 19:6736612-6736634 CCTGCGGCTGGGCCTCCGGGAGG - Exonic
1161852407 19:6744610-6744632 CCTCCAGCTCGGCCTCCGACAGG - Exonic
1162940393 19:14005898-14005920 CCCGCGGCCCGGCCCCCGCGAGG - Intronic
1166140205 19:40801262-40801284 CCCGCCGCGCAGCATCCGTGGGG + Exonic
1166976546 19:46608291-46608313 CCTGCAGCTCTGCTTCAGTGGGG - Exonic
1167226664 19:48248268-48248290 CTCCCACCTCGGCCTCCGGGTGG - Intronic
1168310071 19:55455764-55455786 TCCCCAGCTCGGGCACCGTGGGG + Exonic
1202648511 1_KI270706v1_random:161029-161051 CCAGCAGGTCGGCGTCCCTGCGG - Intergenic
925142696 2:1560840-1560862 CCCCCAGCCCGACCCCCGTGAGG - Intergenic
926158481 2:10471496-10471518 CCAGCAGGGCGGCCCCCGTGGGG + Intergenic
927472253 2:23385359-23385381 CTCGCGGCTCGGGCTCCGGGCGG - Exonic
927565071 2:24104715-24104737 CCAGCAGCTCTGCTTCTGTGTGG + Intronic
934686382 2:96325140-96325162 TCCGCTGCTCGGCCTCCCTGGGG - Intergenic
937917363 2:127105787-127105809 CCCGCTGCGCGGCCGCCGGGTGG - Intronic
938263061 2:129908938-129908960 CCCGCAGCTGGCCCTCCCCGAGG - Intergenic
938319834 2:130355651-130355673 GCCCCAGCTCGGACTCCGCGCGG + Intergenic
941110433 2:161414841-161414863 CGCGCGGCTCGGCGTCCGGGAGG + Intergenic
944096706 2:195976082-195976104 CTTGCAGCTCGGCCACAGTGTGG + Intronic
1169327454 20:4686974-4686996 CCCCGATCTCGGCCTCCGAGGGG - Intronic
1170951337 20:20938867-20938889 ACCGCAGCTGGGCATCTGTGTGG + Intergenic
1172240187 20:33408046-33408068 CCCTCAGCCCTGCCACCGTGGGG - Exonic
1172742406 20:37179320-37179342 CCCGCGGCTCGGACTCCGGCGGG + Exonic
1173751453 20:45479979-45480001 TCCCCAGCTCGGCCTCTGTCGGG + Exonic
1175994314 20:62805349-62805371 CCCGCGCCTCGGCCTCCTGGCGG + Intronic
1176603343 21:8811658-8811680 CCAGCAGGTCGGCGTCCCTGCGG + Intergenic
1178624231 21:34202157-34202179 GCCGCAGCCCGGCCGCCGAGTGG + Intergenic
1180110226 21:45643932-45643954 CCCGTCACTCGGCCTCCGTCGGG - Intronic
1180345628 22:11703215-11703237 CCAGCAGGTCGGCGTCCCTGCGG + Intergenic
1180352087 22:11814097-11814119 CCAGCAGGTCGGCGTCCCTGCGG - Intergenic
1180386121 22:12177969-12177991 CCAGCAGGTCGGCGTCCCTGCGG + Intergenic
1181272116 22:21665273-21665295 CCTGCTGCTGGGCCTCCGAGGGG + Intronic
1181474021 22:23157773-23157795 CCGGCAGCCCAGCCTCAGTGTGG - Intronic
1183986929 22:41575212-41575234 CTCGCAGCTCAGTCACCGTGGGG - Exonic
1184492996 22:44820810-44820832 CACACAGCTCGGCCTCCCTCGGG + Intronic
1184654477 22:45934253-45934275 CCCCCAGCTTGGCCTCTCTGAGG + Intronic
1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG + Intronic
1185230394 22:49677272-49677294 CCAGCAGCTCAGGCTCCTTGGGG - Intergenic
1185386322 22:50532646-50532668 GCCGCCGCTGGGCCTCTGTGTGG + Intergenic
953912179 3:46898788-46898810 CGCGCAGCTCCTCCTCGGTGAGG - Exonic
954242643 3:49306039-49306061 CTTGCAGCTTGGCCTCCTTGAGG - Intronic
957039812 3:75328303-75328325 CCCACATCTCGGCATCCGTCTGG - Intergenic
960951490 3:123001261-123001283 GCCACAGCTCAGCCTCCCTGGGG + Intronic
961678996 3:128586141-128586163 CCAGCAGCACGGCCTCCCCGGGG + Intergenic
962317430 3:134367580-134367602 CCCTCAGCACGGCCTCCATCTGG + Exonic
962753532 3:138451658-138451680 CTCCCACCTCGGCCTCCGCGTGG + Intronic
964118936 3:153162517-153162539 CCCGGCGCCCGGCCTCCGTTCGG + Exonic
965590479 3:170357130-170357152 CCCGCTGCGCGGCGTCCGAGCGG + Intergenic
966863144 3:184241695-184241717 CCCCCAGCTCGGGCTCTGAGGGG + Exonic
967018050 3:185498934-185498956 CCCGCTTCTCGGCCTCCTTCTGG - Exonic
970484702 4:16513324-16513346 CACGCAGCTCAGCCTGTGTGGGG - Intronic
971244024 4:24912728-24912750 CTCCCAGCTCGGCCTCTCTGGGG + Intronic
973374735 4:49278993-49279015 CCAGCAGGTCGGCGTCCCTGTGG - Intergenic
973376536 4:49291034-49291056 CCAGCAGGTCGGCGTCCCTGCGG - Intergenic
973377456 4:49297186-49297208 CCAGCAGGTCGGCGTCCCTGCGG - Intergenic
973379783 4:49312041-49312063 CCAGCAGGTCGGCGTCCCTGCGG + Intergenic
973380686 4:49318181-49318203 CCAGCAGGTCGGCGTCCCTGCGG + Intergenic
973382676 4:49331248-49331270 CCAGCAGGTCGGCGTCCCTGTGG + Intergenic
973386286 4:49516297-49516319 CCAGCAGGTCGGCGTCCCTGCGG + Intergenic
985764474 5:1769488-1769510 CCCGCAGGAGGGCCTCCCTGAGG + Intergenic
990596266 5:57315252-57315274 TCCTCAGCATGGCCTCCGTGAGG + Intergenic
992530224 5:77645681-77645703 CCCGCAGCGCGGCCTCCTCCCGG + Intergenic
1002348535 5:178565326-178565348 CCTGGAGCTGGGCCTCCCTGAGG - Intronic
1006899553 6:37491088-37491110 CCCCCAGTGAGGCCTCCGTGGGG - Intronic
1014350778 6:120342490-120342512 CCCGCAGCTCACCTTCTGTGTGG - Intergenic
1014943983 6:127475550-127475572 CCAGGCGCTCGGCCTCCGAGCGG + Exonic
1015287987 6:131507486-131507508 CCCGAAGCTCGGCGTCCGTGAGG + Intergenic
1018390236 6:163336211-163336233 CCCCCAGCTCTGCCTGCCTGGGG + Intergenic
1019577596 7:1744962-1744984 CGCGCAGCATGCCCTCCGTGAGG - Exonic
1022714959 7:32891301-32891323 CCCGGAGCTCCGCCGCCCTGGGG + Intronic
1022795402 7:33727732-33727754 CCAGCAGCTCTGCCTCCGCCAGG - Exonic
1032069383 7:128794487-128794509 CCTCCAGCTCTGTCTCCGTGAGG - Exonic
1035105777 7:156440681-156440703 CCTGCACCCCGGCCTCCTTGAGG + Intergenic
1035319523 7:158019820-158019842 GCCACAGCTCGGCCTTGGTGTGG + Intronic
1035350998 7:158246429-158246451 CCCCCAGCTCTAACTCCGTGTGG + Intronic
1036604815 8:10295511-10295533 AGAGCAGCTCGGCCTGCGTGGGG - Intronic
1038228472 8:25678787-25678809 CCAGCAGCTTGGCCTCAGTTGGG + Intergenic
1039463263 8:37763198-37763220 CCCTCACCTCGGCCTCCGGGCGG - Intronic
1039494310 8:37969231-37969253 CCCCCAGCTCAGCCTCCCAGAGG - Intergenic
1049200332 8:141336960-141336982 CACACAGCTGGGCCGCCGTGTGG - Intergenic
1049327511 8:142030932-142030954 CCCGCAGCTGGGCCACCCTGTGG + Intergenic
1049393054 8:142381871-142381893 GCCGCAGCTCATCCTGCGTGTGG + Intronic
1051173832 9:14345072-14345094 TCCTGAGCTCGGCCTCCCTGGGG + Intronic
1055321554 9:75088086-75088108 CCCGCAGCTCGCTCCCCGAGAGG + Exonic
1057076395 9:92140425-92140447 CCTGCAGCTCGGCCACCCTGAGG - Intergenic
1057895683 9:98906910-98906932 CCGGCAGCTGGGCCTCCAAGGGG - Intergenic
1060816598 9:126638433-126638455 CCCGCAGCCCTGCCACCCTGGGG + Intronic
1061029035 9:128068559-128068581 CCTGGAGCTCGCCCTCGGTGCGG - Exonic
1061164815 9:128916203-128916225 CCCGCAGCTCGATCTGCGTCAGG - Exonic
1061257081 9:129459494-129459516 CCCCCAGCTCGGCCGCCCTGGGG - Intergenic
1203698440 Un_GL000214v1:117098-117120 CCAGCAGGTCGGCGTCCCTGCGG - Intergenic
1203699357 Un_GL000214v1:123249-123271 CCAGCAGGTCGGCGTCCCTGCGG - Intergenic
1203700301 Un_GL000214v1:129532-129554 CCAGCAGGTCGGCGTCCCTGCGG - Intergenic
1203701223 Un_GL000214v1:135552-135574 CCAGCAGGTCGGCGTCCCTGCGG - Intergenic
1203480052 Un_GL000224v1:4135-4157 CCAGCAGGTCGGCGTCCCTGCGG - Intergenic
1203481025 Un_GL000224v1:10463-10485 CCAGCAGGTCGGCGTCCCTGCGG - Intergenic
1203481985 Un_GL000224v1:16772-16794 CCAGCAGGTCGGCGTCCCTGCGG - Intergenic
1203416762 Un_KI270330v1:472-494 CCAGCAGGTCGGCGTCCCTGCGG + Intergenic
1203549868 Un_KI270743v1:157913-157935 CCAGCAGGTCGGCGTCCCTGCGG + Intergenic
1185482951 X:461151-461173 CCCCCACCGCAGCCTCCGTGTGG - Intergenic
1185627684 X:1493961-1493983 CCCTCAGCTCAGCCTCCCTTTGG - Intronic
1188301007 X:28505627-28505649 CCCGAAGCTCGGCATCAGTGAGG + Intergenic
1190411604 X:50141749-50141771 CCTGCAGCTCTGCCTCTGGGCGG - Intergenic
1199612673 X:149631500-149631522 CCCGCAGCGCGGACTCCCGGGGG + Intronic