ID: 1063371592

View in Genome Browser
Species Human (GRCh38)
Location 10:5525920-5525942
Sequence GCTGAGGGCTGCAGCCCCCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 470
Summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 412}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063371592_1063371602 5 Left 1063371592 10:5525920-5525942 CCAGGGGGGCTGCAGCCCTCAGC 0: 1
1: 0
2: 4
3: 53
4: 412
Right 1063371602 10:5525948-5525970 CCAGGATTCCCGCAGGCTCCTGG 0: 1
1: 0
2: 2
3: 24
4: 218
1063371592_1063371596 -2 Left 1063371592 10:5525920-5525942 CCAGGGGGGCTGCAGCCCTCAGC 0: 1
1: 0
2: 4
3: 53
4: 412
Right 1063371596 10:5525941-5525963 GCCCCCGCCAGGATTCCCGCAGG 0: 1
1: 0
2: 1
3: 11
4: 116
1063371592_1063371607 25 Left 1063371592 10:5525920-5525942 CCAGGGGGGCTGCAGCCCTCAGC 0: 1
1: 0
2: 4
3: 53
4: 412
Right 1063371607 10:5525968-5525990 TGGACTGGAAGCTCCCTCCGCGG 0: 1
1: 0
2: 1
3: 12
4: 172
1063371592_1063371608 29 Left 1063371592 10:5525920-5525942 CCAGGGGGGCTGCAGCCCTCAGC 0: 1
1: 0
2: 4
3: 53
4: 412
Right 1063371608 10:5525972-5525994 CTGGAAGCTCCCTCCGCGGTCGG 0: 1
1: 0
2: 1
3: 14
4: 127
1063371592_1063371603 10 Left 1063371592 10:5525920-5525942 CCAGGGGGGCTGCAGCCCTCAGC 0: 1
1: 0
2: 4
3: 53
4: 412
Right 1063371603 10:5525953-5525975 ATTCCCGCAGGCTCCTGGACTGG 0: 1
1: 0
2: 0
3: 9
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063371592 Original CRISPR GCTGAGGGCTGCAGCCCCCC TGG (reversed) Exonic
900181061 1:1311189-1311211 GCCCAGGGCTGCAGTCCCTCAGG + Intronic
900531298 1:3154732-3154754 GCTGACCGCTGCTGACCCCCAGG + Intronic
900589240 1:3452396-3452418 CCTGAGGCCAGCAGCCCCTCGGG - Intergenic
900707231 1:4088538-4088560 GGTGAGGGCTGAAGACCCCTGGG + Intergenic
900918890 1:5658479-5658501 GCTCAGGGCTCCTGCCTCCCAGG - Intergenic
901462235 1:9398573-9398595 GGTGAGGGCAGCAGCCCCCACGG - Intergenic
901660503 1:10795617-10795639 GCTGTCGGCTGGAGCCCGCCTGG - Intronic
901871935 1:12143298-12143320 GCTGAGGGCTGCAGACATCTGGG - Exonic
902213362 1:14919525-14919547 GCTGAGGTCTTCATACCCCCTGG + Intronic
902234290 1:15047814-15047836 GCTGAGTGCACCATCCCCCCGGG - Intronic
902623737 1:17664945-17664967 GCGGATGGCTGCATCCACCCTGG - Intronic
902670063 1:17966972-17966994 GCAGGGGGCTGGAGCCCGCCAGG - Intergenic
903139074 1:21327718-21327740 GCTGGGGTCCCCAGCCCCCCGGG + Intronic
903280697 1:22248264-22248286 GCTGAAGGCTCCAGACCCACAGG + Intergenic
903742574 1:25566792-25566814 GGTGAGGGCTGGCGCGCCCCAGG - Intronic
903747585 1:25598562-25598584 GGTGGTGGCTGCAGCTCCCCTGG + Intergenic
904237548 1:29124569-29124591 GCTGAGAGCTGCGACCCCGCCGG + Intergenic
905229540 1:36506309-36506331 GGTGGGGGCTGCAGAACCCCAGG - Intergenic
905271495 1:36790536-36790558 GGTCAGGGCTGGAGCGCCCCAGG - Intergenic
905293460 1:36939225-36939247 GCGGAGAGGTGCAGCCCCCAAGG + Intronic
905645689 1:39623711-39623733 GCTGAGTTCTGCAGACCCTCAGG - Intergenic
907110429 1:51921903-51921925 AGAGAGGGCTGAAGCCCCCCAGG + Intronic
907425051 1:54374273-54374295 GCTGCAGGCTGCAGGCCTCCTGG - Intronic
907827340 1:58031535-58031557 GCTGAGGGCTGAAGCCATCCTGG - Intronic
907854679 1:58290887-58290909 GCTGAGAGCTGCAGACCCGAGGG + Intronic
910678498 1:89839359-89839381 GCTCAGGCCTGTAGCCACCCTGG + Intronic
912174709 1:107141310-107141332 GCGGAGGGCGGCAGCTCCCGCGG - Intronic
912382229 1:109253855-109253877 GCACAGGGCTGCCGCCACCCAGG + Intronic
915018780 1:152760655-152760677 GCTGTGGCCCGCAGCCCTCCTGG + Exonic
915733467 1:158070115-158070137 GCTGAAGAGTGCAGCCTCCCAGG + Intronic
915905274 1:159872652-159872674 GTTGGGGGGTGCAGGCCCCCAGG - Intronic
915915168 1:159936589-159936611 GCAGAGGGAGGCAGCACCCCAGG + Intronic
916680001 1:167095032-167095054 GGTGATGGCTGCAGGCTCCCTGG - Intronic
918081507 1:181211199-181211221 ACTGAGGGCTGCATCTCACCAGG - Intergenic
919808500 1:201395001-201395023 GCTGAGCCCTGGAGACCCCCAGG - Intronic
922390705 1:225138359-225138381 GCAGAGGGCTGAAGTCCACCAGG - Intronic
922802815 1:228371907-228371929 GGTGGGGGCTGCAGCCCTCCTGG - Exonic
923673903 1:236064551-236064573 GCTGTGGGCTGCATCGCCGCAGG - Intronic
923750959 1:236745650-236745672 CCTGAGGGCAGCCGCACCCCAGG - Intronic
924770972 1:247078959-247078981 GCTGAGACCTGGCGCCCCCCGGG + Intergenic
1063371592 10:5525920-5525942 GCTGAGGGCTGCAGCCCCCCTGG - Exonic
1063486231 10:6423483-6423505 GCTGGGGGCTGCTGCCCATCAGG + Intergenic
1066002102 10:31114300-31114322 GCTGGGGGCTGCAGCCACTCTGG + Intergenic
1067039250 10:42940255-42940277 GGTGATGGATGCAGCCCACCAGG + Intergenic
1067250338 10:44581191-44581213 GCTGAGGGATGGAGCCCTGCAGG + Intergenic
1067690625 10:48499154-48499176 CCAGAGGGAGGCAGCCCCCCGGG - Intronic
1067720142 10:48722005-48722027 ACTGAGGGCAGCAGCCACCCAGG - Intronic
1067774600 10:49153935-49153957 GCAGATGGCTGCAGCCAGCCAGG - Intergenic
1067852396 10:49762125-49762147 GCTGCGGGCAGCGGCGCCCCAGG + Intronic
1069438521 10:68407282-68407304 GCTGTGGGCTGCAGCGGGCCTGG - Intronic
1070305998 10:75239555-75239577 GATGTGGGCAGCAGCCCCCAGGG + Intergenic
1070741722 10:78907678-78907700 GCTGTGGGCAGGAGCCTCCCTGG - Intergenic
1070826108 10:79391439-79391461 GCTGAGGGCTGGAGCCACTGCGG + Intronic
1070923888 10:80205498-80205520 GCTGACGGCTGCTGCGCCCGCGG - Exonic
1071359266 10:84829309-84829331 GGTGTGAGCTGCAGACCCCCAGG - Intergenic
1071363785 10:84878137-84878159 GATGAAGGATGCAGCCCCTCTGG - Intergenic
1072943140 10:99785365-99785387 GCTGAGGGCTCCTCCCCTCCTGG - Intronic
1073048602 10:100654185-100654207 GCTGGGGGCGGCAGCGGCCCGGG - Intergenic
1073328434 10:102656142-102656164 GCTGAGGGCCCTAGCCCTCCCGG + Intronic
1075833673 10:125433902-125433924 GCTTAGGGGTGCTGACCCCCAGG - Intergenic
1076182710 10:128422895-128422917 GCTGAGGGCTCCCACCCCGCTGG - Intergenic
1076321627 10:129586808-129586830 GCAGAGGGATGCAGCCACTCTGG - Intronic
1076358304 10:129868748-129868770 GCTGAGGGCTGCAGGCCTGGTGG + Intronic
1076404002 10:130200649-130200671 GGTGAGGGCTCCAGCGCCCCTGG + Intergenic
1076424120 10:130355271-130355293 GCTGAACGCTGCAGCCCTCTAGG + Intergenic
1076737734 10:132466238-132466260 GGTGGGGGCTGCATCCCCTCTGG - Intergenic
1076754055 10:132558861-132558883 GCTGTGCGCTGCAGCCTCCGGGG + Intronic
1077036775 11:499185-499207 GCTGAGCTCTGCTGTCCCCCAGG - Exonic
1077094377 11:793105-793127 GCTGGGGGCTGTACCCCCACAGG - Intronic
1077220026 11:1411690-1411712 TGTGAGGGATGCAGCCCCCACGG + Intronic
1077237691 11:1489777-1489799 GCTGATGGCAGGAGCTCCCCAGG - Intronic
1077297224 11:1831912-1831934 GCTGGGGCTGGCAGCCCCCCAGG - Intronic
1077366135 11:2162104-2162126 GCTGAGGCCCTCAGCTCCCCAGG + Intergenic
1077544728 11:3164472-3164494 GCTGGAGTCTGCAGCCCCCCGGG - Intronic
1077555741 11:3225329-3225351 GCTGACCGCGGCAGCCCCGCAGG + Intergenic
1078095911 11:8297105-8297127 GCTGGGGCCAGCAGCCCCCGTGG - Intergenic
1078097592 11:8310240-8310262 GTTGTGGGCTTCAGCCTCCCTGG + Intergenic
1078190742 11:9091272-9091294 GCTGGCGGCTGCAGCTCCGCGGG - Intronic
1078351974 11:10602237-10602259 GCTCAGGGCTGCACCACCCCAGG + Intronic
1078425155 11:11243766-11243788 GCTGAGGGCTGGGTCCCCACTGG + Intergenic
1078532606 11:12148686-12148708 GCTGAAGGCTGCAAGCCCCGGGG - Intronic
1078653139 11:13214614-13214636 GTTGAGGGCTGCTGGCCTCCTGG + Intergenic
1080124469 11:28716055-28716077 TCTGAGGGATGCATCTCCCCGGG + Intergenic
1080641833 11:34162829-34162851 GGTGAGGGCTGAAGTCCCACAGG + Intronic
1082755667 11:57073710-57073732 GTTGGGGTCTGCAGCCCCTCAGG - Intergenic
1083282317 11:61634737-61634759 GATGAGGGCTGCAGAGCCCCTGG + Intergenic
1083562236 11:63681884-63681906 ACTGACGGCTTCAGCCCCCCGGG + Intronic
1083766127 11:64842426-64842448 GGTGAGGCCTGCAGCCCCTAGGG + Intronic
1083803221 11:65058470-65058492 GCTGGGGGCTGCTGCCCTCTTGG - Exonic
1083878414 11:65536789-65536811 GCTGAGAGCTGCAGGCACCCAGG + Intronic
1083895389 11:65617298-65617320 GCTGGGAGCTGCAGCGCACCGGG - Exonic
1083903677 11:65656199-65656221 GCTGGAGGCTGGGGCCCCCCAGG - Intronic
1084400888 11:68942333-68942355 GCTGCAGGCTGTAGCCCACCCGG + Intergenic
1084402155 11:68950886-68950908 AGGGAAGGCTGCAGCCCCCCTGG + Intergenic
1084431899 11:69115866-69115888 GCAGTGGCCTGCAGCACCCCTGG - Intergenic
1084492727 11:69487325-69487347 CGTGAGGGCTGCAGGCCACCAGG + Intergenic
1084674463 11:70625986-70626008 GCTGAGGGCTGCAGGCCTCTGGG + Intronic
1084927441 11:72524849-72524871 TCTGGGGCCTGCAGCTCCCCTGG - Intergenic
1087464334 11:98486000-98486022 GCTGAAGGCTGGAGATCCCCTGG - Intergenic
1088449678 11:109968025-109968047 GCTGAAGGCTCCAGGACCCCTGG - Intergenic
1088835918 11:113577932-113577954 GCTGAGGGGTGGAGCATCCCTGG - Intergenic
1089134068 11:116235352-116235374 CCTGAGGCCTGCAGCTCACCTGG + Intergenic
1089300745 11:117497364-117497386 GCTCAGGGCTGCAGACCTCCTGG + Intronic
1089554979 11:119311258-119311280 GGTGAGGGCTGCATCCCTGCAGG - Exonic
1090669046 11:128933362-128933384 GGTGTGGGCTGCAGCCGCACTGG + Intergenic
1090870808 11:130745736-130745758 GCTGGGGGCTGGAGCCCTCAAGG - Intergenic
1090981203 11:131724202-131724224 GGTGAGGGGTGCAGGCGCCCTGG - Intronic
1091280420 11:134378755-134378777 GATGAAGGCTGCAGTCCACCAGG + Intronic
1091285341 11:134405614-134405636 GCTGGGGGCTGCCACCCCCGGGG - Intronic
1096504910 12:52086651-52086673 GCTCAGAGCTGCAGCCTCTCTGG + Intergenic
1096603498 12:52747456-52747478 GCTGTGGTCTACAGCTCCCCAGG + Intergenic
1097133819 12:56835124-56835146 ACTGAGGGCTGAAGAGCCCCTGG - Intergenic
1101736430 12:107466618-107466640 GCCGAAGTCTGCAGACCCCCAGG - Intronic
1102601913 12:114037704-114037726 GCTGGCGGCTGCAGCTGCCCTGG + Intergenic
1103366758 12:120389529-120389551 TCAGAGGCCTGCAGCCCCCTGGG + Intergenic
1103563198 12:121803410-121803432 GGCGAGGGCTGCATCCTCCCAGG + Intergenic
1103934122 12:124466333-124466355 AAGGAGGGCTGCAGCCCCCAGGG + Intronic
1104217230 12:126746015-126746037 CCTGAGGGCAGGAGTCCCCCGGG - Intergenic
1104749671 12:131230228-131230250 GCTGATGGCTGCAGCCAGCCCGG - Intergenic
1105071355 12:133235951-133235973 GCTGAGGGGCGCCGGCCCCCGGG - Exonic
1106204028 13:27572473-27572495 GCTGAGGGCTGCACCTCCTGAGG + Intronic
1106337487 13:28796821-28796843 GCAGAGGGCAACAGCCCCCACGG - Intergenic
1107832822 13:44389668-44389690 GCCGAGACCAGCAGCCCCCCTGG + Intronic
1107992677 13:45832082-45832104 GGTGTGGGGTGCAGCCACCCAGG + Intronic
1108144479 13:47462692-47462714 GCTGAGGGCAGTCGCGCCCCAGG - Intergenic
1108178022 13:47813837-47813859 GCAGAGGCCTGGAGCCCTCCAGG - Intergenic
1108747271 13:53408774-53408796 GCTGAGGTCTGCAGGCCACTGGG + Intergenic
1108802380 13:54115415-54115437 GCTGATGGCTGCAATCCCCTGGG + Intergenic
1111469295 13:88656902-88656924 GCTGAGGGCAGCCACACCCCAGG - Intergenic
1113226466 13:108165017-108165039 GCTGGGGGCAGCTGCCCCCATGG - Intergenic
1113464486 13:110504006-110504028 GCTGGGGCCTGGAGCCCCTCGGG + Intronic
1113790226 13:113024593-113024615 GCCGAGGGCTCCATGCCCCCGGG - Intronic
1113818751 13:113195280-113195302 TCTGAGGCCTGCAGCCTGCCTGG - Intronic
1113881141 13:113627282-113627304 GCTGAGCTCTGCAGCACCACAGG - Intronic
1113910611 13:113839590-113839612 CCTCAGGGCTGCAGCCTCCTTGG + Intronic
1114237637 14:20836258-20836280 GCTCAGGTCTGCATCCCCCGTGG - Intergenic
1114347176 14:21808300-21808322 GCTGATGGCGGCAGCCTCTCTGG - Intergenic
1115543280 14:34442496-34442518 GTTGAGGTCTGCAGGACCCCTGG - Intronic
1116862114 14:50003293-50003315 GCTCACGGCTGCAGCCGCCCGGG + Intronic
1119933002 14:78566264-78566286 GCTGAGGACAGTAGCCTCCCTGG - Intronic
1119970540 14:78965316-78965338 TCTGAGGGCCTAAGCCCCCCAGG + Intronic
1121105967 14:91279948-91279970 GCTGAGGGCACCTGCCCACCTGG + Intronic
1121569512 14:94936859-94936881 GCCGAGGGCTGCCGCGCACCGGG + Intergenic
1121928383 14:97949359-97949381 GCTAAGGGCTGCAGACCTCCAGG + Intronic
1122290093 14:100676099-100676121 GGTGAGGGCTCCAGCCCCCTTGG - Intergenic
1122442404 14:101741086-101741108 GCAGAGGGCTGGAGCCCTCATGG - Intergenic
1122533150 14:102443123-102443145 GCAGAGGGCTGCAGCGCTGCTGG - Intronic
1122801322 14:104231090-104231112 GCTCAGGTCTGCAGCTTCCCAGG + Intergenic
1122837719 14:104438197-104438219 CCTGAGGGCTGCAGGCCCCCGGG + Intergenic
1122946150 14:105011041-105011063 GCCTAGGGCTGCAGCCCCACTGG + Exonic
1123050731 14:105540793-105540815 GCTTAGGGCTGCAGAGCCCTGGG + Intergenic
1123505662 15:20940064-20940086 GCTGGAGGCTGCAGCCTACCGGG - Intergenic
1123562897 15:21513771-21513793 GCTGGAGGCTGCAGCCTACCGGG - Intergenic
1123599143 15:21951054-21951076 GCTGGAGGCTGCAGCCTACCGGG - Intergenic
1124037479 15:26069200-26069222 GCTGAGTGCTGCAGTCCTTCAGG + Intergenic
1128475888 15:67996539-67996561 GCTGATGTCTGCAGCCCTCTGGG + Intergenic
1128705459 15:69834760-69834782 GTTTAGGGGTCCAGCCCCCCGGG - Intergenic
1129271443 15:74421339-74421361 GGTGAGGGCTGCTGGCCCCTGGG + Intronic
1129658246 15:77538986-77539008 GCTCAGGGCTCCAGTCCCCTGGG - Intergenic
1132095055 15:98978045-98978067 GCTGAGGGCTGCTGCCCAAAAGG + Intronic
1202971248 15_KI270727v1_random:240905-240927 GCTGGAGGCTGCAGCCTACCGGG - Intergenic
1132506499 16:312229-312251 GCTGAGGGCAGCTGCCCCACCGG + Intronic
1132643883 16:990018-990040 CCTGAGGGCTCCTGCCCCCCTGG - Intergenic
1132665775 16:1080723-1080745 GGTGAAGGCTGCAGCCCTCCAGG + Intergenic
1132676963 16:1124892-1124914 GCTGGGCGCTCCAGCTCCCCTGG + Intergenic
1132701040 16:1222237-1222259 GCTGAAGGATGCTGCCCCCGGGG + Exonic
1132724856 16:1334151-1334173 GCTGGGGGGTGCAGCCCGCCCGG - Intronic
1132791595 16:1692559-1692581 GATCAGAGCTGCAGCCTCCCTGG + Intronic
1132845166 16:1997890-1997912 GCTGAGGGCTGCAGCCCGTGGGG - Exonic
1132855712 16:2043775-2043797 CCTGGGGGCTGCATCCTCCCAGG - Intronic
1133220151 16:4316249-4316271 GCTGAGGTAGGAAGCCCCCCGGG + Intronic
1133234207 16:4380281-4380303 GCTGGGGGCTGCGGGCCGCCAGG - Intronic
1136285151 16:29236401-29236423 GCCCAGGCCTGCAGCCCCCAGGG + Intergenic
1136428523 16:30184323-30184345 ACTGGGGGCTCCAGCACCCCCGG - Intronic
1136568402 16:31083058-31083080 GCTGAGGTCTGCAGGCCACTGGG - Exonic
1137440672 16:48496633-48496655 GCTGAGGGCCGCAGCTCTGCCGG + Intergenic
1137644974 16:50066003-50066025 GCTGACGGCTGCAGCACACATGG - Exonic
1138264446 16:55650497-55650519 GCTGAGCCCTGCAGTCCCCATGG - Intergenic
1138269010 16:55681319-55681341 GGTGATGGCTCCAGCCCCCTGGG - Intronic
1138542137 16:57694930-57694952 GATCAGGGCTGGAGGCCCCCAGG - Intronic
1138591377 16:58001162-58001184 GCTGCTGTCTGCAGCCACCCGGG - Intronic
1138659985 16:58511212-58511234 GCTGCTGGCCGCAGCCCCCTAGG + Intronic
1139391598 16:66609203-66609225 GCTTAGGACAGCAGCCCCGCTGG + Intronic
1140456756 16:75110156-75110178 GCAGAGGGCTGCAGCATGCCAGG - Exonic
1141701676 16:85645217-85645239 GCTGAGGGCTGCTGCCCCTGAGG - Intronic
1141710469 16:85695989-85696011 GCTGAGTGCAGCATCCCACCAGG + Intronic
1142090214 16:88206025-88206047 GCCCAGGCCTGCAGCCCCCAGGG + Intergenic
1142126692 16:88414083-88414105 GCTGGAGGCTGCAGGCCCTCAGG + Intergenic
1142149151 16:88505126-88505148 GCTGGGGGCTGCAGCACCTGGGG + Intronic
1142203602 16:88772421-88772443 GCTGGGGCCTGCAGGCTCCCAGG - Intronic
1142209733 16:88803404-88803426 GCTCGAGCCTGCAGCCCCCCAGG + Exonic
1142365095 16:89645954-89645976 GCTGCCGGCCGCAGCCCCGCGGG + Exonic
1142727965 17:1830158-1830180 GCTCGGGGCCGCAGCCACCCCGG - Intronic
1143268595 17:5659045-5659067 GGTGAGGGGTGAAGCCTCCCTGG - Intergenic
1143375302 17:6463677-6463699 GCTGCTGGCTCCTGCCCCCCAGG + Intronic
1143474878 17:7196790-7196812 ACTGAGGTCTGCAGGGCCCCCGG + Exonic
1143897140 17:10145147-10145169 GCTCAGGGCTGCAGACGCCCTGG + Intronic
1144028946 17:11302767-11302789 GCTGAGAGCTGCAACCCTTCGGG - Intronic
1144519445 17:15944567-15944589 GGAGGGGGCTGCAGCCCCCGAGG + Intergenic
1144659197 17:17057451-17057473 GCTGAAGGCTGGAGACCCCAGGG + Intronic
1144946330 17:18971376-18971398 ACGGAGGGCTCAAGCCCCCCGGG - Exonic
1145209059 17:20999907-20999929 GGTGAGCACTGCAGCCTCCCTGG - Exonic
1145797734 17:27665714-27665736 GCTGAGGGCTGATGTCCACCTGG - Intergenic
1146577358 17:34006336-34006358 ACTCTGGGCTGCAGCCACCCTGG - Intronic
1148147059 17:45372699-45372721 ACTCAGGGCTCCAGCTCCCCAGG + Intergenic
1148579512 17:48734104-48734126 GCTGAGAGCTATAGCCCCGCAGG - Intergenic
1149461408 17:56833251-56833273 GCTGCAGGCTGCAGCCCGCGTGG + Exonic
1150251460 17:63707112-63707134 GCTGAGGGCTCCCTCCCTCCAGG + Intronic
1150289401 17:63972883-63972905 GCTGCGCACTGCAGCTCCCCAGG - Exonic
1151743665 17:76000640-76000662 GCTGTGGGCTGCAGCCTCTCAGG + Intronic
1151836416 17:76585586-76585608 GCTGAGGGCTGCGGGCCGCCGGG + Intronic
1151862265 17:76773251-76773273 GCGGAGGCCAGCAGCCCCCATGG - Intronic
1151882817 17:76905147-76905169 GCTGAGGTCTGGACCCCTCCAGG + Exonic
1152230582 17:79112322-79112344 GTTGAGGGGTGCATCCCACCTGG + Intronic
1152372011 17:79894544-79894566 GATGGGGGCTGCAGGCTCCCAGG - Intergenic
1152559762 17:81072120-81072142 TCTGAGGGCTGGAGCCAGCCGGG - Intronic
1152651050 17:81493118-81493140 GCTCGGGCCTGCAGCCCCCAGGG - Intergenic
1152677255 17:81648051-81648073 GCGGCGGGCCGCAGCCCTCCAGG - Exonic
1152886259 17:82852286-82852308 GCTGGGGGCTGCATCGCCCACGG - Intronic
1153882653 18:9434497-9434519 CCTGACCGCTGCAGCCCCCGGGG - Intergenic
1155343433 18:24835876-24835898 GCTGAGCTCTGCAGCTCCCAAGG - Intergenic
1155926249 18:31658604-31658626 CCTGTGGGCTGCAGCCCCGGGGG + Intronic
1156213892 18:34977184-34977206 GCTGAGGTCTGCAGCCCGCGGGG + Intronic
1156336321 18:36175676-36175698 GCTGAGGGCTGGAGGCAGCCAGG + Intronic
1157418607 18:47526473-47526495 CCTGGGGGCAGCAGCCACCCAGG - Intergenic
1157496288 18:48159861-48159883 TCTGGGGGCTGGAGGCCCCCTGG - Intronic
1157598135 18:48876178-48876200 CCTGGGGGCTGCAGCCAACCTGG - Intergenic
1157722474 18:49936154-49936176 GCTGAAGGCCACAGACCCCCAGG + Intronic
1159960918 18:74555341-74555363 ACCAAGGGCTGCAGCCCCCTTGG + Intronic
1160542194 18:79630100-79630122 CCTGATGGCAGCAGCCCCCGAGG + Intergenic
1160673085 19:375578-375600 GGGGAGGGCAGCAGCCCCCTGGG - Intronic
1160739378 19:678977-678999 GCTGAGGGCTGCAGACCCGAAGG + Intronic
1161087988 19:2343928-2343950 GCTGAGGGCGGCCCCCACCCCGG - Intronic
1161222380 19:3123588-3123610 GCCGGGGGCTGCTGCCGCCCGGG - Exonic
1161236766 19:3202076-3202098 GCTGGGGGCAGAAGCACCCCTGG + Intronic
1161436916 19:4268942-4268964 GCTTAGGGCTGCAACATCCCTGG + Exonic
1161518922 19:4712920-4712942 GCTGGGGGCTGCAGCACACGCGG + Intronic
1162088331 19:8261859-8261881 GCTTAGGGCTGGGGCCCCCGGGG - Intronic
1163230984 19:16002030-16002052 GCTGATAGCTCCAGCTCCCCAGG - Intergenic
1164261617 19:23572679-23572701 GCTGAAGGGAGCAGCCCCACAGG - Intronic
1164415491 19:28043758-28043780 GCTGAGGACTGCCCCTCCCCAGG + Intergenic
1164598542 19:29546224-29546246 GCTGGGGGCTGCATGCACCCAGG - Intronic
1165080370 19:33302992-33303014 GCTCTGCGCTGCAGCCTCCCCGG - Intergenic
1165191139 19:34064461-34064483 ATTCAGGGCTGCAGACCCCCAGG - Intergenic
1165441520 19:35831089-35831111 GCTGGGGGCTGAAGTCCCTCAGG + Exonic
1165859402 19:38899437-38899459 GCTGAATGCTGCAGGCCCCGGGG - Intronic
1165956336 19:39504078-39504100 GCTCAGGGCTGCAGCCTGCTCGG - Exonic
1167004559 19:46767135-46767157 GCTGAGGGGTGCAGGAGCCCGGG - Intronic
1167079175 19:47267556-47267578 GCTGAGGGCAGCAGCTGCCTGGG + Intronic
1167561575 19:50229098-50229120 GCTCAGGGCTGTTGTCCCCCAGG + Intronic
925087202 2:1117517-1117539 CGTGAGGGCTCCAGCTCCCCAGG - Intronic
925977393 2:9150728-9150750 GCTTAGGGCTGCTGGCCCCTCGG + Intergenic
926624619 2:15080808-15080830 TCTGAGAGCTCCATCCCCCCAGG - Intergenic
927104355 2:19810875-19810897 GCTGATGGCTGGAGCCCAGCTGG + Intergenic
927109043 2:19851284-19851306 GCTCATGGCTGCAGCATCCCCGG - Intergenic
927143324 2:20144458-20144480 GCTGAGGACAGAAGCCCTCCTGG - Intergenic
927606663 2:24491814-24491836 GCTGGGGGCTGCTCCCCGCCGGG + Intergenic
927698092 2:25251349-25251371 GCTGCGGGCTGCTCACCCCCAGG + Intronic
927948025 2:27149105-27149127 TCTGTGGGCTGCAGCCCCAGTGG + Exonic
928023611 2:27722383-27722405 ACTGAGGGCTGCAGGCTCCTGGG - Intergenic
928373832 2:30759404-30759426 GCTGAGGGCTGCCGGCTCCCGGG - Intronic
928435638 2:31252936-31252958 GCTGAGGTCAGCACCGCCCCAGG - Intronic
929575126 2:43046633-43046655 GCTGAGGTCACCAGTCCCCCCGG + Intergenic
932780182 2:74554555-74554577 GCCGGGAGCTGCAGCACCCCAGG - Exonic
932976004 2:76600338-76600360 GCTAAAGACTGCAGCCTCCCAGG - Intergenic
934857923 2:97740198-97740220 GCTGGGGTCTTCACCCCCCCAGG + Intergenic
935624774 2:105163089-105163111 ACTGAGGGCTGCAGCTACCCAGG + Intergenic
936596502 2:113853278-113853300 GCTTAGGGATACAGCCCCCGAGG + Intergenic
937004221 2:118496617-118496639 GCTGTGGGATGCGGCCGCCCTGG + Intergenic
937012142 2:118572288-118572310 GCTGTGGGCCTCAGCCTCCCTGG + Intergenic
937220015 2:120337330-120337352 GCTGGGGGCTGGAGCCACCCTGG - Intergenic
937229684 2:120390412-120390434 CCTGTGGGCTGCAGCCCCTCTGG + Intergenic
937430264 2:121832221-121832243 GGAGAGGGCTGCAGCCTCCTGGG + Intergenic
938638687 2:133256818-133256840 GATGAGGGCTGCAGCCCCAAAGG - Intronic
942070529 2:172311865-172311887 GCAGAGGGCTGCAGCACCTTTGG + Intergenic
945119659 2:206444057-206444079 GCTGGGCGCAGCAGCCCCCCAGG - Exonic
946147047 2:217738884-217738906 TCTGAGGGCTGCAGCCCCATGGG + Intronic
947743745 2:232497123-232497145 CCTGAGGGTTGCACCGCCCCAGG + Intergenic
947958204 2:234213033-234213055 TCTGAGGGCAGGAGCCCCGCAGG + Intergenic
948164382 2:235850089-235850111 GCTGTGGGCTGCAGAGCCCTGGG - Intronic
948454685 2:238099491-238099513 CCTGGGGGCTGCTGCACCCCTGG - Intergenic
948800852 2:240432929-240432951 GCTGGGAGCTGCGGGCCCCCCGG + Intergenic
948927758 2:241110468-241110490 GAGGAGGCCTGCAGCCCCGCAGG + Intronic
949045196 2:241869709-241869731 GCTGAGGGCTGCGCCCGCCGGGG - Exonic
1168963462 20:1884583-1884605 GCTGAGTGCTGTTGTCCCCCTGG - Intergenic
1169140368 20:3224272-3224294 CCTGCGGGCTGCAGGCCCCTCGG + Intergenic
1169216894 20:3799380-3799402 GCTGGGCACAGCAGCCCCCCGGG + Intronic
1169234804 20:3922440-3922462 GCTGAGGGCTGCCCTCCCTCGGG + Intronic
1170247921 20:14244699-14244721 GCTGAGCGCTGGAGCCTCCAGGG + Intronic
1170900532 20:20457968-20457990 GCTGAGGGAGGCAGGGCCCCTGG + Intronic
1170991277 20:21303636-21303658 GCTGTGGGATTCAGCACCCCGGG + Intronic
1171255120 20:23684633-23684655 GCAGAGGGGTGCAGCCCTCAGGG - Intergenic
1171412697 20:24957623-24957645 GCTGAGGCCAGCATCCCCCAGGG + Intronic
1172654342 20:36527863-36527885 GCTGAGGACTGACGGCCCCCTGG - Exonic
1173575940 20:44113054-44113076 GCTGTGGGCTGAGGCCTCCCAGG - Exonic
1173849650 20:46209988-46210010 GCTGCTGGCTGCAGCCACACTGG - Intronic
1173924833 20:46773117-46773139 GGTGAGAGCTGCAGGCACCCTGG + Intergenic
1174038415 20:47682510-47682532 GCTGAGGGCTGCGGCCCACGTGG + Intronic
1174398888 20:50265106-50265128 CCTGTGGGCTGCAGCCACACAGG + Intergenic
1175310872 20:58010921-58010943 GCTGAAGGCTGCAGGCTCCCAGG - Intergenic
1175429359 20:58891201-58891223 GCGGAGGGAGGCGGCCCCCCGGG - Intronic
1175754830 20:61522867-61522889 GCAGAGGGCTCCGGCCCACCCGG - Intronic
1175854569 20:62113593-62113615 ACTGAGCCTTGCAGCCCCCCTGG - Intergenic
1176070000 20:63221290-63221312 GCTGAGGCCTGCAGACCAGCAGG - Intergenic
1176292906 21:5055671-5055693 GCTGAGAGCAGCTGCCCCCAGGG + Intergenic
1177894571 21:26844535-26844557 GCTGAGGGCGGCAGCCGAGCTGG + Exonic
1177973287 21:27816920-27816942 CCTAAGGTCTGCAGCCTCCCTGG - Intergenic
1178268557 21:31167936-31167958 ACTGAGGGGTGTAGCCCCTCAGG - Intronic
1179655513 21:42842059-42842081 ACCGAGGGCCACAGCCCCCCCGG - Intergenic
1179864354 21:44207979-44208001 GCTGAGAGCAGCTGCCCCCAGGG - Intergenic
1179886362 21:44315878-44315900 GCACAGGGCTGCAGCTCCACGGG - Intronic
1179928164 21:44550024-44550046 GCTGGGGCCTGCCACCCCCCGGG + Intronic
1179939519 21:44628690-44628712 GCTGGGGCCTGCCACCCCCCGGG - Intronic
1179985627 21:44919134-44919156 ACCGAGGGCCACAGCCCCCCCGG + Intronic
1180070718 21:45434777-45434799 TCTGGGGGCTGCAACCCACCGGG - Intronic
1180622565 22:17171755-17171777 GCGGATGGCTGCGGCCCCCCGGG - Intergenic
1182123121 22:27799552-27799574 ACTGAGGGCTCCAGACCCACAGG + Exonic
1182280108 22:29213633-29213655 GCTGAGGGCTGCTGAGCACCTGG - Intronic
1182720731 22:32396957-32396979 GCTGAGGGCAGCCACGCCCCAGG + Intronic
1183332266 22:37228053-37228075 CCTGAGGGCTTCAGGCCTCCTGG - Intronic
1183587397 22:38760840-38760862 GTTGGGGGCTGCAGCCCTGCAGG - Intronic
1183738169 22:39655262-39655284 GCAGAGGTCAGCTGCCCCCCGGG - Intronic
1184188918 22:42881995-42882017 GGTAATGCCTGCAGCCCCCCAGG + Intronic
1184244483 22:43228951-43228973 GCTGAGGCCTCAGGCCCCCCAGG + Intronic
1184467438 22:44677122-44677144 GCTGAGGTCTGCACCCTCCTGGG - Exonic
1184533297 22:45070544-45070566 GCAGAGGGCTGGAGACACCCAGG + Intergenic
1184644207 22:45887671-45887693 GCCGAGGTCTGCAGGCCACCTGG - Intergenic
1184829551 22:46975491-46975513 GCTGAGAGCTGGGGCCTCCCGGG + Intronic
1185026533 22:48417387-48417409 GCTGAGGCCCGCAGCCTCCCTGG + Intergenic
1185037630 22:48488291-48488313 GCTGGGGGCTTGAGCACCCCAGG - Intergenic
949604454 3:5637737-5637759 TATGAGGGCTCCAGACCCCCAGG + Intergenic
950285209 3:11739408-11739430 GCTGATGGCTCCAGCTCCCAGGG + Intergenic
950680166 3:14579825-14579847 GCTGAGAGGAGCAGCCTCCCTGG + Intergenic
950872861 3:16244398-16244420 GCTGCTGGCTGCAGCCACACAGG + Intergenic
952416164 3:33093112-33093134 GGTCTGGGCTGCAGCCCTCCAGG + Exonic
952919610 3:38275700-38275722 CCACAGGGCTGCAGCCTCCCTGG + Intronic
953814408 3:46142636-46142658 GCAGAGCGCTGCTGTCCCCCTGG + Intergenic
954364725 3:50139745-50139767 GCTGAGGGCTTCAGCCTCCCAGG - Intergenic
954383325 3:50231232-50231254 GCTGGGAGCTGCTGCCCCTCTGG - Intronic
954444377 3:50539066-50539088 CCTGAGGGCTCCAGCTCCCAGGG + Intergenic
958582519 3:96045002-96045024 GCTGAGGGGTGGAGCCCTCATGG - Intergenic
960139689 3:114140094-114140116 TCTGAGGGCTGCATCCCTCCTGG - Intronic
961003715 3:123390817-123390839 GCTGAGGTCTGCATCCCCGAGGG + Intronic
961619554 3:128212943-128212965 GCAGAGGACTGCTGCTCCCCGGG - Intronic
961822948 3:129584562-129584584 GCTGAGGGCTCCTTGCCCCCAGG - Exonic
968504690 4:966419-966441 GCTGAGGGCTGCTGGTTCCCTGG + Intronic
968525951 4:1057254-1057276 GCTGAGGCCTGCAGGCAGCCAGG + Intronic
968703354 4:2066978-2067000 GCTGAGGGCTGAAGCGCCTCGGG + Exonic
969053162 4:4386768-4386790 GCTGCGGGCTGCGCCACCCCGGG - Exonic
971855774 4:32041412-32041434 GCTGAGGGATGCAGGCCCCATGG + Intergenic
972064780 4:34927970-34927992 GCTGAAGGCTCGAGACCCCCTGG + Intergenic
973993751 4:56436278-56436300 GCTGAGGGCTGCGACCGCGCCGG - Exonic
978811949 4:112859512-112859534 CCTGAGGGCTGGAGCCTTCCTGG - Intronic
982122779 4:152158475-152158497 GCTCTGGGCTGCAGCCACCCTGG - Intergenic
984847572 4:184120757-184120779 GCTGCAGGCTGCAGAACCCCAGG + Intronic
985792492 5:1937711-1937733 CCTCAGGGCTGCAGCTGCCCGGG + Intergenic
985802412 5:2013375-2013397 GCTCAGGGCTCCCACCCCCCAGG - Intergenic
985899794 5:2779715-2779737 GCTGAGGGAAGCAGCCTCGCAGG + Intergenic
987062858 5:14258894-14258916 GATGAGGGCTGCAGTCCTGCTGG + Intronic
989107271 5:37875334-37875356 GCTGAGAGCTGCACCCCACCGGG - Intergenic
991120226 5:63004433-63004455 GCTGAAGGCTGGAGAGCCCCTGG + Intergenic
993320226 5:86461608-86461630 ACTGAGGTCAACAGCCCCCCAGG + Intergenic
994881136 5:105498181-105498203 GCTGAGAGCTGCACTCCCTCTGG + Intergenic
998151806 5:139761828-139761850 GGTGAGGGCTGCAGACAGCCAGG - Intergenic
1001515968 5:172355499-172355521 GCTGAAGGATGCAGGACCCCAGG - Intronic
1002320683 5:178373813-178373835 CCTGAGGGAGGCAGCCCCCTGGG - Intronic
1002605535 5:180380768-180380790 TCTGAGGACTGCAGCCTCCTGGG - Intergenic
1002616010 5:180456760-180456782 ACTGAGGGTTGCAGGGCCCCAGG + Intergenic
1003493437 6:6643024-6643046 AGTGAGGGCTGCATCCTCCCAGG + Intronic
1004213261 6:13674597-13674619 GCTGAGGGCAGCCACCACCCAGG + Intronic
1006116604 6:31779170-31779192 CCTGGGGGCTCCCGCCCCCCAGG - Exonic
1007257780 6:40540807-40540829 GCAGAGGTCTGCAGACGCCCAGG + Intronic
1007702569 6:43773341-43773363 GGTGAGAGCTGGAGACCCCCAGG + Intronic
1018235723 6:161721731-161721753 TCAGAGGGCTGCTGCCTCCCTGG + Intronic
1018417692 6:163615354-163615376 GCTGAAGGCAGCAGCCACCTGGG + Intergenic
1019281068 7:200491-200513 GCTGAGGCCTGGGGCCACCCAGG + Intronic
1019427414 7:984136-984158 ACTCAGGGCTTGAGCCCCCCAGG + Intronic
1019437672 7:1030415-1030437 GCAGTGGGGTGCAGTCCCCCGGG + Intronic
1019501947 7:1369070-1369092 GCGCAGGCCCGCAGCCCCCCAGG + Intergenic
1019547717 7:1586425-1586447 TCTGGGGGCCGCAGTCCCCCGGG - Intergenic
1020619043 7:10496531-10496553 GCTGAGGTCTGCAGCCACTTGGG + Intergenic
1022971004 7:35517199-35517221 GCTGAGTTCTGCAGAGCCCCAGG - Intergenic
1023343688 7:39249346-39249368 CCTGAGCTCTGCAGCACCCCTGG + Intronic
1023909631 7:44544205-44544227 GCTGATGGCTGCCTCACCCCCGG - Intergenic
1024151497 7:46576343-46576365 GATGAGGCCTGCAGTCTCCCAGG - Intergenic
1024329110 7:48139117-48139139 GCTGAGGTCTGCTGGACCCCCGG + Intergenic
1024715815 7:52078230-52078252 GCAGAGGGCTGCTTCCCCCAAGG + Intergenic
1026874429 7:73871282-73871304 GCTGAGGGGTGGGGCCCCCAGGG + Intergenic
1026949405 7:74337484-74337506 GCTGAGGGCCTGAGCCCACCTGG + Intronic
1027707248 7:81549868-81549890 GTTGAGGTCTGCAGGCCCCCCGG - Intergenic
1032011440 7:128350636-128350658 GCTGAGGGCATCAGCACCCAGGG + Exonic
1033125861 7:138706601-138706623 GCTGAGGGCTGCACCTCCCACGG - Exonic
1033363885 7:140656865-140656887 ACTGAGGCCAACAGCCCCCCAGG + Intronic
1033487925 7:141809798-141809820 GCTGAAGGCTGGAGAGCCCCTGG + Intergenic
1033584621 7:142764892-142764914 GCAGAGGGAGGCAGGCCCCCTGG + Intergenic
1034302390 7:150028246-150028268 GCACAGGGCTCCAGCCCCCGTGG - Intergenic
1034398900 7:150848401-150848423 CCTCGGGGCAGCAGCCCCCCAGG + Intronic
1034803671 7:154069072-154069094 GCACAGGGCTCCAGCCCCCGTGG + Intronic
1035188050 7:157141067-157141089 GCTGCAGGCTGCTGCCCCTCCGG + Intronic
1035360851 7:158313450-158313472 GCAGAGGGCTCCAGCTGCCCAGG + Intronic
1036016179 8:4787297-4787319 GCTGAGGGCTGCGACCGCGCCGG - Intronic
1036796175 8:11758175-11758197 CCTGAGGGCTGAAGCCATCCTGG + Intronic
1038179971 8:25218351-25218373 GCTGAGCTCTGCGGCCACCCCGG - Intronic
1038258167 8:25970161-25970183 GCAGAGGGCTGCAGCCAGGCAGG + Intronic
1039390945 8:37180410-37180432 GATGAGGGTTCCAGCCCCCAAGG + Intergenic
1040310702 8:46235357-46235379 CCTGAGGACTGCAGCCCACCAGG - Intergenic
1041030669 8:53732820-53732842 ACAGAGGCCAGCAGCCCCCCAGG + Intronic
1041240441 8:55844759-55844781 GCTGGGGGCTGCCCGCCCCCTGG - Intergenic
1041391175 8:57348817-57348839 GCTGAGGCCTGCAGGCTGCCTGG + Intergenic
1042871597 8:73404976-73404998 AATGAGGGCAGCAGCCCCCTCGG - Intergenic
1043180872 8:77085124-77085146 GCTGAAGGCTGGAGAGCCCCTGG - Intergenic
1048738257 8:137525896-137525918 GCTGAGGGCTGATCCTCCCCTGG + Intergenic
1048881672 8:138877083-138877105 GCAGAGGGCTGATGGCCCCCAGG - Intronic
1049222565 8:141434669-141434691 GGGGTGGGCTACAGCCCCCCAGG - Intergenic
1049352065 8:142169825-142169847 GCTGAGGGTGTCAGGCCCCCGGG - Intergenic
1049352082 8:142169875-142169897 GCTGAGGGTGTCAGGCCCCCGGG - Intergenic
1049420328 8:142513605-142513627 ACAGAGGTCTGCAGCCGCCCAGG + Intronic
1050182404 9:2934889-2934911 GAGGAGGGCTGCAGCCCTTCGGG + Intergenic
1050204410 9:3181729-3181751 GCTCAGGGCTGCCGCCCCGCTGG - Intergenic
1050377215 9:4985418-4985440 GCTGAGGGCTGCTGCGGCGCAGG + Exonic
1051374437 9:16389340-16389362 GCTGAGTGTTGCGGCTCCCCTGG - Intergenic
1053158282 9:35795181-35795203 GCTGAGAACTGCAGCCTACCAGG + Intronic
1056091471 9:83209523-83209545 GCCAAGGGCTGCAGACCCCTGGG + Intergenic
1056588293 9:87943929-87943951 GCTGAGGGCTGCAGCCCCTGCGG - Intergenic
1056785320 9:89588603-89588625 GTGGAGAGCTGAAGCCCCCCTGG - Intergenic
1057030686 9:91773112-91773134 GCAGAGGGCTGCAGGGGCCCTGG - Intronic
1057211054 9:93201344-93201366 GCTGGGGTCAGCAGCCCACCTGG - Intronic
1057217350 9:93236353-93236375 GCTGGGGGCTCCAGCACCCAGGG + Intronic
1057505144 9:95627451-95627473 GGTGAGGCCCTCAGCCCCCCAGG + Intergenic
1057517915 9:95737383-95737405 GCTGGAGGCGGCAGACCCCCTGG - Intergenic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1059439965 9:114301338-114301360 GCTGAGGGATGCAGCACTGCAGG + Intronic
1059580806 9:115546460-115546482 GCTGAAGGCTGGAGAACCCCTGG - Intergenic
1059656214 9:116360127-116360149 GCTGAGGTCTGCAGCCCTTTAGG + Intronic
1059881679 9:118697314-118697336 GCTGAAGGCTGGAGAGCCCCTGG + Intergenic
1060779284 9:126399731-126399753 CTAGAGGGCTGCAGCCCACCAGG - Intronic
1060811723 9:126614240-126614262 GGCGCGGGCTGCAGCCGCCCCGG + Intergenic
1060819321 9:126652235-126652257 GGAGGGGGCTGCAGGCCCCCAGG + Intronic
1061193476 9:129095230-129095252 GCTGGGGCCTGCAGGCCCCCTGG + Exonic
1061201071 9:129138879-129138901 GCTGAGGGCAGCAGATCTCCGGG - Intronic
1061377784 9:130236351-130236373 CCTGGGGGCTGCAACCCCACCGG + Exonic
1061619517 9:131802543-131802565 CATGAGGGCTGCTGTCCCCCTGG - Intergenic
1061645077 9:131994532-131994554 GCAGAGGTCTGCAGTCCTCCAGG - Intronic
1061674751 9:132209463-132209485 TCTCAGGGCTGCAGCCCGCCCGG - Intronic
1061912876 9:133734170-133734192 GCTGAGGCCTGGAGCCCCCATGG - Exonic
1062028775 9:134352621-134352643 GCTGAGCCCTGCAGCTCCCGGGG + Intronic
1062040264 9:134401323-134401345 GCTGAGGGTTGGAGCGACCCAGG + Intronic
1062249976 9:135589016-135589038 GCTGTGGGCCGCAGCCCTTCTGG + Intergenic
1062272325 9:135715096-135715118 GCTGAGGGCTGGCGTCCTCCAGG + Intronic
1062355109 9:136158219-136158241 CCTGAAGGCTGCAGCCCACAGGG - Intergenic
1062396985 9:136356547-136356569 GCCCAGGGCCGCAGCCCACCTGG - Exonic
1062490568 9:136803138-136803160 GCCCAGGGCTGGGGCCCCCCAGG + Intronic
1062490619 9:136803273-136803295 GCCCAGGGCTGGGGCCCCCCAGG + Intronic
1062523573 9:136969509-136969531 GCTGAGGCCTGGGGCCTCCCTGG + Intronic
1062600975 9:137318444-137318466 GGAGCGGGCTGCAGCCCCCACGG - Intronic
1202778596 9_KI270717v1_random:14943-14965 GCTGAGAGCATCAGCACCCCCGG + Intergenic
1186463268 X:9765324-9765346 GCTGAGGGCTTGAGGCCCGCGGG - Intronic
1186618642 X:11215037-11215059 GCTGAGAGCTGGAGCTGCCCAGG + Intronic
1190735087 X:53250687-53250709 GCTGATGGCTGCAGCCCCCATGG - Exonic
1191150740 X:57219351-57219373 GCTCAGGTCTGCATCCCCCATGG + Intergenic
1192079405 X:68032745-68032767 GCTGTCTGCTGCAGCCACCCTGG - Intergenic
1193360101 X:80571475-80571497 GCTGGGGGATGCACCCCACCTGG + Intergenic
1194506510 X:94739640-94739662 GCTGAGGTCTGCAGCACTCACGG - Intergenic
1198084311 X:133268149-133268171 ACTGGGGTCTGCAGACCCCCAGG - Intergenic
1200146055 X:153926988-153927010 CCTGAGGGGGGCAGCCCCCTCGG + Intronic
1200152515 X:153958204-153958226 GCTGAAGACTGCAGCCGCCCAGG - Exonic
1202165201 Y:21980136-21980158 GCTGAGGCAAACAGCCCCCCAGG + Intergenic
1202226155 Y:22606238-22606260 GCTGAGGCAAACAGCCCCCCAGG - Intergenic
1202316960 Y:23589427-23589449 GCTGAGGCAAACAGCCCCCCAGG + Intergenic
1202553805 Y:26080631-26080653 GCTGAGGCAAACAGCCCCCCAGG - Intergenic