ID: 1063371592

View in Genome Browser
Species Human (GRCh38)
Location 10:5525920-5525942
Sequence GCTGAGGGCTGCAGCCCCCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 470
Summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 412}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063371592_1063371596 -2 Left 1063371592 10:5525920-5525942 CCAGGGGGGCTGCAGCCCTCAGC 0: 1
1: 0
2: 4
3: 53
4: 412
Right 1063371596 10:5525941-5525963 GCCCCCGCCAGGATTCCCGCAGG 0: 1
1: 0
2: 1
3: 11
4: 116
1063371592_1063371602 5 Left 1063371592 10:5525920-5525942 CCAGGGGGGCTGCAGCCCTCAGC 0: 1
1: 0
2: 4
3: 53
4: 412
Right 1063371602 10:5525948-5525970 CCAGGATTCCCGCAGGCTCCTGG 0: 1
1: 0
2: 2
3: 24
4: 218
1063371592_1063371607 25 Left 1063371592 10:5525920-5525942 CCAGGGGGGCTGCAGCCCTCAGC 0: 1
1: 0
2: 4
3: 53
4: 412
Right 1063371607 10:5525968-5525990 TGGACTGGAAGCTCCCTCCGCGG 0: 1
1: 0
2: 1
3: 12
4: 172
1063371592_1063371608 29 Left 1063371592 10:5525920-5525942 CCAGGGGGGCTGCAGCCCTCAGC 0: 1
1: 0
2: 4
3: 53
4: 412
Right 1063371608 10:5525972-5525994 CTGGAAGCTCCCTCCGCGGTCGG 0: 1
1: 0
2: 1
3: 14
4: 127
1063371592_1063371603 10 Left 1063371592 10:5525920-5525942 CCAGGGGGGCTGCAGCCCTCAGC 0: 1
1: 0
2: 4
3: 53
4: 412
Right 1063371603 10:5525953-5525975 ATTCCCGCAGGCTCCTGGACTGG 0: 1
1: 0
2: 0
3: 9
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063371592 Original CRISPR GCTGAGGGCTGCAGCCCCCC TGG (reversed) Exonic