ID: 1063374299

View in Genome Browser
Species Human (GRCh38)
Location 10:5544835-5544857
Sequence GTGTGTGTGCACATGTACGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063374299_1063374305 4 Left 1063374299 10:5544835-5544857 CCCACGTACATGTGCACACACAC No data
Right 1063374305 10:5544862-5544884 ACCAGTGGCCAAGTCAAGGAGGG No data
1063374299_1063374309 20 Left 1063374299 10:5544835-5544857 CCCACGTACATGTGCACACACAC No data
Right 1063374309 10:5544878-5544900 AGGAGGGACAAAGAAGGTGAAGG No data
1063374299_1063374308 14 Left 1063374299 10:5544835-5544857 CCCACGTACATGTGCACACACAC No data
Right 1063374308 10:5544872-5544894 AAGTCAAGGAGGGACAAAGAAGG No data
1063374299_1063374302 0 Left 1063374299 10:5544835-5544857 CCCACGTACATGTGCACACACAC No data
Right 1063374302 10:5544858-5544880 TACCACCAGTGGCCAAGTCAAGG No data
1063374299_1063374304 3 Left 1063374299 10:5544835-5544857 CCCACGTACATGTGCACACACAC No data
Right 1063374304 10:5544861-5544883 CACCAGTGGCCAAGTCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063374299 Original CRISPR GTGTGTGTGCACATGTACGT GGG (reversed) Intergenic
No off target data available for this crispr