ID: 1063374308

View in Genome Browser
Species Human (GRCh38)
Location 10:5544872-5544894
Sequence AAGTCAAGGAGGGACAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063374300_1063374308 13 Left 1063374300 10:5544836-5544858 CCACGTACATGTGCACACACACT No data
Right 1063374308 10:5544872-5544894 AAGTCAAGGAGGGACAAAGAAGG No data
1063374299_1063374308 14 Left 1063374299 10:5544835-5544857 CCCACGTACATGTGCACACACAC No data
Right 1063374308 10:5544872-5544894 AAGTCAAGGAGGGACAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063374308 Original CRISPR AAGTCAAGGAGGGACAAAGA AGG Intergenic
No off target data available for this crispr