ID: 1063375004

View in Genome Browser
Species Human (GRCh38)
Location 10:5549070-5549092
Sequence TGAATCACTTAGAGTGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063375004_1063375009 -1 Left 1063375004 10:5549070-5549092 CCCAGTTCACTCTAAGTGATTCA No data
Right 1063375009 10:5549092-5549114 ATCGAGGGCGTAAACTCTGAGGG No data
1063375004_1063375010 5 Left 1063375004 10:5549070-5549092 CCCAGTTCACTCTAAGTGATTCA No data
Right 1063375010 10:5549098-5549120 GGCGTAAACTCTGAGGGCGATGG No data
1063375004_1063375012 15 Left 1063375004 10:5549070-5549092 CCCAGTTCACTCTAAGTGATTCA No data
Right 1063375012 10:5549108-5549130 CTGAGGGCGATGGAGGCATCAGG No data
1063375004_1063375008 -2 Left 1063375004 10:5549070-5549092 CCCAGTTCACTCTAAGTGATTCA No data
Right 1063375008 10:5549091-5549113 CATCGAGGGCGTAAACTCTGAGG No data
1063375004_1063375013 16 Left 1063375004 10:5549070-5549092 CCCAGTTCACTCTAAGTGATTCA No data
Right 1063375013 10:5549109-5549131 TGAGGGCGATGGAGGCATCAGGG No data
1063375004_1063375011 8 Left 1063375004 10:5549070-5549092 CCCAGTTCACTCTAAGTGATTCA No data
Right 1063375011 10:5549101-5549123 GTAAACTCTGAGGGCGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063375004 Original CRISPR TGAATCACTTAGAGTGAACT GGG (reversed) Intergenic
No off target data available for this crispr