ID: 1063376318

View in Genome Browser
Species Human (GRCh38)
Location 10:5556683-5556705
Sequence AGCTTCACTCCTGAGCCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063376318_1063376322 9 Left 1063376318 10:5556683-5556705 CCCAGGGGCTCAGGAGTGAAGCT No data
Right 1063376322 10:5556715-5556737 CTATGCCTGGCTTCCTGAGCAGG No data
1063376318_1063376326 30 Left 1063376318 10:5556683-5556705 CCCAGGGGCTCAGGAGTGAAGCT No data
Right 1063376326 10:5556736-5556758 GGTACAATTCCGAGCACCTCGGG No data
1063376318_1063376321 -4 Left 1063376318 10:5556683-5556705 CCCAGGGGCTCAGGAGTGAAGCT No data
Right 1063376321 10:5556702-5556724 AGCTTCGTGGACTCTATGCCTGG No data
1063376318_1063376325 29 Left 1063376318 10:5556683-5556705 CCCAGGGGCTCAGGAGTGAAGCT No data
Right 1063376325 10:5556735-5556757 AGGTACAATTCCGAGCACCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063376318 Original CRISPR AGCTTCACTCCTGAGCCCCT GGG (reversed) Intergenic
No off target data available for this crispr