ID: 1063376389

View in Genome Browser
Species Human (GRCh38)
Location 10:5557140-5557162
Sequence GCGCAGAGCTTCCGCCACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063376389_1063376393 -7 Left 1063376389 10:5557140-5557162 CCTTGGTGGCGGAAGCTCTGCGC No data
Right 1063376393 10:5557156-5557178 TCTGCGCCTGGTGCTGGAGGAGG No data
1063376389_1063376395 0 Left 1063376389 10:5557140-5557162 CCTTGGTGGCGGAAGCTCTGCGC No data
Right 1063376395 10:5557163-5557185 CTGGTGCTGGAGGAGGCCTGAGG No data
1063376389_1063376398 21 Left 1063376389 10:5557140-5557162 CCTTGGTGGCGGAAGCTCTGCGC No data
Right 1063376398 10:5557184-5557206 GGATCAGGAGATCTTCCTCCAGG No data
1063376389_1063376392 -10 Left 1063376389 10:5557140-5557162 CCTTGGTGGCGGAAGCTCTGCGC No data
Right 1063376392 10:5557153-5557175 AGCTCTGCGCCTGGTGCTGGAGG No data
1063376389_1063376396 6 Left 1063376389 10:5557140-5557162 CCTTGGTGGCGGAAGCTCTGCGC No data
Right 1063376396 10:5557169-5557191 CTGGAGGAGGCCTGAGGATCAGG No data
1063376389_1063376399 22 Left 1063376389 10:5557140-5557162 CCTTGGTGGCGGAAGCTCTGCGC No data
Right 1063376399 10:5557185-5557207 GATCAGGAGATCTTCCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063376389 Original CRISPR GCGCAGAGCTTCCGCCACCA AGG (reversed) Intergenic
No off target data available for this crispr