ID: 1063376805

View in Genome Browser
Species Human (GRCh38)
Location 10:5558827-5558849
Sequence ACTGGACGAAGGGCAGGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063376805_1063376809 -8 Left 1063376805 10:5558827-5558849 CCAGGTCCTGCCCTTCGTCCAGT No data
Right 1063376809 10:5558842-5558864 CGTCCAGTTCCCAGTTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063376805 Original CRISPR ACTGGACGAAGGGCAGGACC TGG (reversed) Intergenic
No off target data available for this crispr