ID: 1063377268

View in Genome Browser
Species Human (GRCh38)
Location 10:5561810-5561832
Sequence TTGGAGTCACTCTGCCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063377268_1063377281 25 Left 1063377268 10:5561810-5561832 CCAAGATGGCAGAGTGACTCCAA No data
Right 1063377281 10:5561858-5561880 CCACCCCCGTCCTCCTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063377268 Original CRISPR TTGGAGTCACTCTGCCATCT TGG (reversed) Intergenic
No off target data available for this crispr