ID: 1063378039

View in Genome Browser
Species Human (GRCh38)
Location 10:5565871-5565893
Sequence TTCCTCCGTGCAGATTAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063378036_1063378039 16 Left 1063378036 10:5565832-5565854 CCGAAGGAAGATGGTTTCAGGAT No data
Right 1063378039 10:5565871-5565893 TTCCTCCGTGCAGATTAAGGAGG No data
1063378032_1063378039 22 Left 1063378032 10:5565826-5565848 CCTGCCCCGAAGGAAGATGGTTT No data
Right 1063378039 10:5565871-5565893 TTCCTCCGTGCAGATTAAGGAGG No data
1063378035_1063378039 17 Left 1063378035 10:5565831-5565853 CCCGAAGGAAGATGGTTTCAGGA No data
Right 1063378039 10:5565871-5565893 TTCCTCCGTGCAGATTAAGGAGG No data
1063378033_1063378039 18 Left 1063378033 10:5565830-5565852 CCCCGAAGGAAGATGGTTTCAGG No data
Right 1063378039 10:5565871-5565893 TTCCTCCGTGCAGATTAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063378039 Original CRISPR TTCCTCCGTGCAGATTAAGG AGG Intergenic