ID: 1063379218

View in Genome Browser
Species Human (GRCh38)
Location 10:5573971-5573993
Sequence GAACCCAGTTTGGCTGCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063379218_1063379224 9 Left 1063379218 10:5573971-5573993 CCTCTAGCAGCCAAACTGGGTTC No data
Right 1063379224 10:5574003-5574025 GGCCCATTAAGTTGCAAATCCGG No data
1063379218_1063379228 29 Left 1063379218 10:5573971-5573993 CCTCTAGCAGCCAAACTGGGTTC No data
Right 1063379228 10:5574023-5574045 CGGCCTTCATCACACCTCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063379218 Original CRISPR GAACCCAGTTTGGCTGCTAG AGG (reversed) Intergenic
No off target data available for this crispr