ID: 1063382103

View in Genome Browser
Species Human (GRCh38)
Location 10:5591895-5591917
Sequence GTGTGCGCGTGCACGTGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063382103_1063382104 11 Left 1063382103 10:5591895-5591917 CCTCTGCACGTGCACGCGCACAC No data
Right 1063382104 10:5591929-5591951 ACACACACAAACACACACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063382103 Original CRISPR GTGTGCGCGTGCACGTGCAG AGG (reversed) Intergenic