ID: 1063382103 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:5591895-5591917 |
| Sequence | GTGTGCGCGTGCACGTGCAG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1063382103_1063382104 | 11 | Left | 1063382103 | 10:5591895-5591917 | CCTCTGCACGTGCACGCGCACAC | No data | ||
| Right | 1063382104 | 10:5591929-5591951 | ACACACACAAACACACACCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1063382103 | Original CRISPR | GTGTGCGCGTGCACGTGCAG AGG (reversed) | Intergenic | ||