ID: 1063391255

View in Genome Browser
Species Human (GRCh38)
Location 10:5651153-5651175
Sequence CTGGAAGTTTCCTCCTTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 300}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063391255_1063391266 26 Left 1063391255 10:5651153-5651175 CCCAGAAAGGAGGAAACTTCCAG 0: 1
1: 0
2: 1
3: 36
4: 300
Right 1063391266 10:5651202-5651224 TGCCAACTCACCGCTCATGCAGG 0: 1
1: 0
2: 0
3: 6
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063391255 Original CRISPR CTGGAAGTTTCCTCCTTTCT GGG (reversed) Intronic
901537630 1:9892860-9892882 GGGGAGGTTTCCTCCTTCCTTGG - Intronic
902532788 1:17101231-17101253 CTGGACTTTTCCTCCTCACTAGG - Intronic
902892847 1:19457045-19457067 CTGGAACTTCCTGCCTTTCTGGG - Intronic
904806989 1:33139267-33139289 CTGTAAGTTCCCTCCCATCTTGG + Intergenic
905619222 1:39427663-39427685 CAGGCAGTTTACTCATTTCTAGG - Intronic
908825572 1:68129744-68129766 CTGTTAGTTTCCCCCTCTCTTGG + Intronic
909321351 1:74290050-74290072 CAGGAGGTTTCCACTTTTCTGGG - Intronic
909412363 1:75369872-75369894 CTGGAAGTTTTCCCATTGCTTGG + Intronic
910536113 1:88299729-88299751 TTGGAAACTTTCTCCTTTCTAGG - Intergenic
910769257 1:90814190-90814212 CTGGAAGTTTTCTCTTTGTTAGG + Intergenic
911164869 1:94715492-94715514 CAGGAAGTTTCCATCTTTTTAGG - Intergenic
911669523 1:100592344-100592366 GTGCTAGATTCCTCCTTTCTGGG + Intergenic
912254877 1:108048375-108048397 CTGAAAGTTTTCTGCTTTCCTGG - Intergenic
912456904 1:109804051-109804073 CTGGAAGAGTCCTCTTCTCTGGG + Intergenic
913087012 1:115448478-115448500 AGGGAAGGTTCCTCCTTTTTTGG - Intergenic
913239001 1:116811666-116811688 CTGGAATTTTCCTACTTGTTAGG + Intergenic
913976387 1:143460390-143460412 CTGTAGGTTTCCTCATTTTTGGG - Intergenic
914070787 1:144286005-144286027 CTGTAGGTTTCCTCATTTTTGGG - Intergenic
914108368 1:144680349-144680371 CTGTAGGTTTCCTCATTTTTGGG + Intergenic
916200825 1:162270099-162270121 CTGGAAGTGTGCTCCTTGCCTGG + Intronic
916624293 1:166537379-166537401 ATGAAAGTTTTCTCCTTTTTTGG - Intergenic
917154637 1:171983488-171983510 ATGGACGTCTCCTCTTTTCTTGG + Intronic
917624257 1:176829866-176829888 CTGGAAGGTCCCACCTTACTGGG + Intronic
918432600 1:184477562-184477584 CTGGTAGTTTTTCCCTTTCTGGG - Exonic
918456275 1:184719954-184719976 TTGGAAGTTTGATCCCTTCTCGG + Intronic
920201894 1:204264714-204264736 CTGGGACCTTCCTCCTCTCTTGG - Intronic
920336368 1:205247921-205247943 CTTGAGGTCTCCTACTTTCTTGG - Intronic
922590269 1:226770142-226770164 CTTTAGGTTTCCTCCTTGCTGGG - Intergenic
923619719 1:235568676-235568698 CTGATATTTTCCTCCTTTGTGGG + Intronic
924732811 1:246727583-246727605 CAGGACCTTTTCTCCTTTCTTGG - Intronic
1062830990 10:605816-605838 GAGGACGCTTCCTCCTTTCTTGG - Intronic
1063391255 10:5651153-5651175 CTGGAAGTTTCCTCCTTTCTGGG - Intronic
1063666620 10:8064708-8064730 ATGCCACTTTCCTCCTTTCTTGG + Intronic
1064637110 10:17379627-17379649 CTGGAAGTTCCCTCCCTGCTTGG + Intronic
1065040637 10:21691836-21691858 TTGGTACTTTCCTTCTTTCTAGG - Intronic
1066207815 10:33207138-33207160 AGGGAAGTTGCCTGCTTTCTGGG + Intronic
1067747313 10:48945576-48945598 CTGGAGGTTCACTCCTTTCTGGG - Intronic
1068386556 10:56335782-56335804 CTAGAAGTCTACTCATTTCTAGG + Intergenic
1069884634 10:71615967-71615989 CTGGAATTTGCCCCATTTCTGGG + Intronic
1070527521 10:77308120-77308142 CTGGCATTTTCCTCTCTTCTGGG - Intronic
1071165536 10:82801999-82802021 GTGGAATTTTCCTACTTTTTTGG - Intronic
1072500258 10:96008516-96008538 CTGGAAGTCTCCTACATTATTGG - Intronic
1073126881 10:101156480-101156502 GTGGAAGTTCCCTCCTCTATGGG + Intergenic
1073368713 10:102967403-102967425 CTGGAAGTTTCCTTTCTTCTGGG + Intronic
1073553764 10:104428164-104428186 CTGGAAGTTCACTCCTCCCTTGG - Intronic
1074641772 10:115392542-115392564 CTAGTATTTTCCTCCTTTCCTGG + Intronic
1075434682 10:122427030-122427052 CTGTAGGTTTCCTGCTCTCTGGG + Exonic
1075832563 10:125423843-125423865 GGGGAAGTTTCCTCCGTTCTGGG - Intergenic
1075846529 10:125549389-125549411 CGGGAAGTTGCCTCCTTCCTAGG - Intergenic
1076696727 10:132250819-132250841 TTGGAACCTTCCTCCTCTCTGGG - Intronic
1077597476 11:3546445-3546467 CTGGAACTTTCTTCCTCTGTGGG + Intergenic
1078907669 11:15702931-15702953 CTGGAGGTTTCCATCTTTCCAGG - Intergenic
1080109852 11:28554376-28554398 CTGGAAGCTGCCTCATTCCTTGG + Intergenic
1081703790 11:45168523-45168545 CTTGAGGTTTCCTCCCCTCTGGG + Intronic
1082177822 11:49082185-49082207 CTGGACGGTTCCTGCTTTTTTGG - Intergenic
1082217668 11:49594165-49594187 CTTGCATTTTCCTTCTTTCTGGG - Intergenic
1082903833 11:58285032-58285054 CTGGAGGTTTCTTCCTCCCTAGG - Intergenic
1084264960 11:68000159-68000181 CAGGAAGTTTCCACCTCTCTGGG + Intronic
1085060514 11:73441733-73441755 TTGGCAGTTTCTTTCTTTCTAGG + Intronic
1085126428 11:74005638-74005660 CTGGGAGTCCCCTCCTTACTGGG + Intronic
1085385858 11:76157913-76157935 GTGGAAGTTTCCTCCTGTCAGGG - Intergenic
1086646268 11:89224721-89224743 CTGGAAGTTTTTCCCATTCTGGG - Intronic
1088738095 11:112745232-112745254 CTGGAGGTGTCCTCCTAACTGGG + Intergenic
1089859455 11:121575794-121575816 CGTGAAGTTTCCTTCTTACTAGG - Intronic
1090348352 11:126089319-126089341 CAGGAATTTTTTTCCTTTCTAGG - Intergenic
1091317117 11:134622376-134622398 ATGGAAGTATCGTCCTTTGTAGG + Intergenic
1092423661 12:8355739-8355761 CTGGAACTTTCTTCCTCTGTGGG + Intergenic
1092778332 12:11963177-11963199 GTGGAAGTTTCTTCCTTTATGGG + Intergenic
1094701965 12:32878657-32878679 CGAGAAGTTTGCCCCTTTCTGGG + Intronic
1095663731 12:44769485-44769507 CTGGAATTTTCCTACCTTGTTGG + Intronic
1096187147 12:49588656-49588678 CAGGAAGTTATCTCCTCTCTAGG + Intronic
1096218003 12:49809074-49809096 GAGCAAGTTTCCTCCTTCCTCGG - Intronic
1097634873 12:62110429-62110451 CTGGAATTTTCTTTTTTTCTTGG + Intronic
1097717883 12:62985644-62985666 CTGAATGTTTCATCTTTTCTTGG - Intergenic
1098454396 12:70655976-70655998 CTCGAGGGATCCTCCTTTCTTGG - Intronic
1099841822 12:87975883-87975905 CTGGAAACTTCCTTCTTGCTGGG - Intergenic
1099888580 12:88561830-88561852 CTGCCAGTTTTCTCCTTTTTGGG + Intronic
1099923854 12:88993427-88993449 ATGCAAGTGTCCACCTTTCTGGG - Intergenic
1100400595 12:94225891-94225913 CAGAATGTTTCCTCATTTCTTGG + Intronic
1101140518 12:101790982-101791004 ATGAAAGTTTTCTGCTTTCTTGG - Intronic
1101756627 12:107625967-107625989 CTAAAAGTTTCCTGCCTTCTAGG + Intronic
1101762138 12:107667511-107667533 CAGGAAGTTTGCTTGTTTCTAGG + Intergenic
1102928225 12:116842953-116842975 CTGGCTGCTTCCTGCTTTCTCGG + Intronic
1107096585 13:36544131-36544153 CTGGAACCTTCATGCTTTCTTGG + Intergenic
1108663122 13:52604111-52604133 AAGGAAGTTTTCTTCTTTCTTGG - Intergenic
1109035141 13:57248805-57248827 CAGGATGTTCCCTCTTTTCTTGG + Intergenic
1109303030 13:60609110-60609132 CTGAAAGTTTCCTCCCTTACAGG - Intergenic
1109749306 13:66668958-66668980 CTAGAATTTTCATCCTCTCTAGG + Intronic
1110312200 13:74063263-74063285 CTGGAAGAAGTCTCCTTTCTGGG + Intronic
1110963861 13:81666247-81666269 TTGGAAGTTTCCTCCTAAATTGG + Intergenic
1111078875 13:83276617-83276639 ATGGCATTTTCCTCCTTTTTTGG + Intergenic
1112130195 13:96515075-96515097 CTGCAAGTCTCCTACTTTCCAGG - Intronic
1113419339 13:110158302-110158324 CTGGAAGGTGCCTCCTATGTAGG - Intronic
1114337405 14:21705457-21705479 CTGGTAGTTTACGTCTTTCTAGG + Intergenic
1116474021 14:45318881-45318903 CCTGAATTTTCCTCCTTTCAAGG + Intergenic
1118012785 14:61627011-61627033 CTGGAAGGTGCCTCCTCACTGGG - Intronic
1118116120 14:62778815-62778837 CTGCTAGTCTCATCCTTTCTTGG + Intronic
1119542540 14:75450252-75450274 CTGGAAGGCTACTGCTTTCTGGG - Intronic
1120719640 14:87877020-87877042 CTGAAATATTCCTCCTTTCCGGG - Intronic
1121253763 14:92517096-92517118 CTGGAAGATTCCACCTGTCATGG + Intronic
1121261436 14:92569150-92569172 CTGTAAGTTTCATCTCTTCTGGG + Intronic
1121307580 14:92916759-92916781 CTGGAAGTTTCCTCCCTAGGAGG + Intergenic
1121850387 14:97217177-97217199 ATGGAAGTCTCTTCATTTCTTGG - Intergenic
1122133025 14:99617000-99617022 CAGGAAGGATCCTCCTTCCTGGG - Intergenic
1122286206 14:100654288-100654310 CTGAAAGTTTCGTCCTCTGTAGG - Intergenic
1202928864 14_KI270725v1_random:21407-21429 CTGGAGGTTTCCTCCATTCATGG + Intergenic
1123706986 15:22957786-22957808 TTGGAAGTTTCTACTTTTCTGGG - Intronic
1125082905 15:35696643-35696665 CTATAAGTTTCCTCCTGCCTTGG + Intergenic
1125086875 15:35740358-35740380 CTGGGAGTTTCCTCCATGCTTGG - Intergenic
1126238472 15:46413490-46413512 CTTCTGGTTTCCTCCTTTCTTGG + Intergenic
1126430623 15:48580052-48580074 CTTGAAATTTCCACCCTTCTTGG + Intronic
1127032529 15:54879883-54879905 CTGGAATAGTTCTCCTTTCTGGG + Intergenic
1127396309 15:58546330-58546352 CTGGAAGTTTCCTCGTTCCAGGG + Intronic
1127922491 15:63504469-63504491 CTGGAGGCTTCCGCCTTTCCAGG - Intergenic
1132632899 16:928505-928527 CTGGAAGTCTCCACCTTCCCAGG - Intronic
1136375213 16:29861357-29861379 CTGGAAGTGTCCGCCTGCCTGGG + Intronic
1137738622 16:50742755-50742777 CTTTCAGTTTCCCCCTTTCTAGG + Exonic
1138252452 16:55512573-55512595 TTTCTAGTTTCCTCCTTTCTGGG - Intronic
1138256620 16:55569443-55569465 CTGGCAGCTTTCCCCTTTCTTGG - Intronic
1138802842 16:60055977-60055999 CTCATAGTTTCCTCATTTCTGGG + Intergenic
1139948839 16:70659596-70659618 CTGACTGTTTCCTCCTTTCCAGG + Exonic
1144148416 17:12420396-12420418 ATGGAAGTTTCATCCTTTTGGGG + Intergenic
1147514941 17:41107077-41107099 TTGAAATTTTCATCCTTTCTGGG - Intergenic
1149411220 17:56409278-56409300 CTGAAAGTCAGCTCCTTTCTTGG - Intronic
1149862264 17:60128679-60128701 CAGGAAGTTTCCTTCTTGCCTGG + Intergenic
1150785010 17:68155066-68155088 CTTGAAGTGTCCTTCTGTCTTGG + Intergenic
1151264302 17:72942221-72942243 CTGGCTGCTACCTCCTTTCTGGG - Intronic
1151368976 17:73635507-73635529 CTGGAAATTTCCCCCTTCCCTGG - Intronic
1153545422 18:6200000-6200022 CTGGCAGCTTCCTCCTTCCAGGG - Intronic
1153648903 18:7221759-7221781 CAGGAAGTTTGCTCCTGTCTGGG - Intergenic
1154297807 18:13165581-13165603 CTGGAAGTTTCCTTCTCCTTTGG - Intergenic
1156200057 18:34820642-34820664 CTGGAAGTTTGCTCAATGCTCGG - Intronic
1156398350 18:36718644-36718666 CTGGAAGTGTCCACCTTAATGGG - Exonic
1156450947 18:37266277-37266299 GTGGAAGTTTCACCCTTGCTGGG - Intronic
1156455724 18:37292580-37292602 CAGCAAGTTTCCTCCATTCCAGG - Intronic
1156523476 18:37742483-37742505 CTGGAAGATTCCTCCCTCCCAGG - Intergenic
1156872112 18:41957236-41957258 CTGGAAGTCACCAGCTTTCTAGG - Intronic
1157695081 18:49716160-49716182 CTGCCAGATTTCTCCTTTCTGGG - Intergenic
1159558218 18:69967179-69967201 CTTGAAGCAGCCTCCTTTCTGGG + Intergenic
1159624304 18:70674064-70674086 CTGAAAGTTTCCTGATGTCTAGG + Intergenic
1159891601 18:73958454-73958476 ATGGCAGTTTCCTCTTTACTAGG - Intergenic
1161688871 19:5719375-5719397 CTGTTAGTTTTCTCCTTACTTGG - Intronic
1164715684 19:30388757-30388779 GTGTAAGATTCCTTCTTTCTTGG + Intronic
1164754945 19:30682311-30682333 CTTATAGATTCCTCCTTTCTTGG - Intronic
1164997206 19:32730385-32730407 AGGGAAGTTTCCTTCTTTCAAGG + Intronic
1165117319 19:33536751-33536773 GTGGAGGTTTTCTCCTTCCTTGG - Intergenic
1166185946 19:41138935-41138957 CTTGCAGTTTCCACCTTTCCAGG - Intergenic
1167615302 19:50529865-50529887 CTGGAACTTTCCCCCTCTCTGGG + Intronic
1167885307 19:52495078-52495100 CTCAAAGGTTCCTCCTGTCTTGG + Intronic
1167913501 19:52722126-52722148 CTCAAAGGTTCCTCCTGTCTTGG - Intronic
1167921131 19:52784153-52784175 CTCAAAGTTTCCTCCTGTCTTGG - Intronic
1168613365 19:57818566-57818588 CTGGAAGTCCCCTCCCTGCTTGG - Intronic
925164056 2:1704676-1704698 CTGGAAGCTCCCTCCCCTCTTGG - Intronic
925479070 2:4250504-4250526 CTGTCAGTTTTCTTCTTTCTGGG + Intergenic
926655415 2:15399286-15399308 CAGGGAGTTTCTTCCTTGCTGGG - Intronic
932903169 2:75723459-75723481 CTGGCAGTTTCCGTCCTTCTCGG + Intergenic
933453859 2:82496726-82496748 CAGGAAATTTCCTACATTCTAGG - Intergenic
933533879 2:83546958-83546980 CTGGAAGTTTCCTGCTTTTATGG - Intergenic
934181091 2:89621365-89621387 CTGTAGGTTTCCTCATTTTTGGG - Intergenic
934291389 2:91695606-91695628 CTGTAGGTTTCCTCATTTTTGGG - Intergenic
936578314 2:113673560-113673582 CTGCAGGATTCCTTCTTTCTAGG + Intergenic
936650962 2:114425481-114425503 CTGGAAGTTGCCACATCTCTAGG + Intergenic
939053654 2:137335336-137335358 CTGGAGATGTCCTCCTTCCTTGG - Intronic
939119312 2:138097882-138097904 CAAGTAGTGTCCTCCTTTCTGGG - Intergenic
939149398 2:138455713-138455735 CTAGAAGTTTCCTTCTCCCTGGG - Intergenic
940102193 2:150054193-150054215 CTGAAAGTTTCCTCTCTTCCTGG + Intergenic
940333217 2:152498192-152498214 CTCCAAGATTCCTGCTTTCTGGG - Intronic
940450876 2:153835075-153835097 CTTGAAGTTGCCTCCTCTCATGG + Intergenic
940659927 2:156533572-156533594 CAGGAAGTTTTCTCTTATCTTGG - Intronic
941303898 2:163836799-163836821 CTGGAATCTACCTTCTTTCTGGG + Intergenic
943031826 2:182694691-182694713 CTTGAATTTTTCTTCTTTCTGGG - Intergenic
943311161 2:186326318-186326340 CTGGAACATTCCTTCTTCCTGGG - Intergenic
943755915 2:191556983-191557005 TTGTAAGTTTCCTCCTTAATTGG + Intergenic
944497213 2:200319162-200319184 CTCGAAGTCTTCTCCTTTCAGGG + Intronic
945145503 2:206733896-206733918 CTGGCAGTCTCCTCCTTTGTAGG - Intergenic
947100847 2:226619832-226619854 CTGGAGGCTCCCTCTTTTCTAGG - Intergenic
947167914 2:227281188-227281210 CTTCAAGTTTCTTCCTTTATAGG - Intronic
1169946906 20:10998642-10998664 CTGGATGTTTCTTCTTGTCTTGG - Intergenic
1170507526 20:17043120-17043142 AAGGAATTTTGCTCCTTTCTAGG - Intergenic
1170536240 20:17343807-17343829 CTGGAGGCTTCCTCATTCCTTGG - Intronic
1170713394 20:18811715-18811737 CTGGAAACTTCGTTCTTTCTGGG - Intronic
1173026774 20:39314921-39314943 CTCTTAGTTTCCTCATTTCTTGG - Intergenic
1173645466 20:44630500-44630522 CTGAATGTTCCCTCCTTTCAAGG - Intronic
1174199330 20:48796185-48796207 CTGTAAGTTTATTCATTTCTGGG - Intronic
1174821441 20:53729839-53729861 CTGAGAGGTTCTTCCTTTCTGGG - Intergenic
1176065104 20:63190396-63190418 CTGGACGTCCCCTCCTGTCTGGG + Intergenic
1176590886 21:8649994-8650016 CTGGAGGTTTCCTCCATTCATGG + Intergenic
1177700282 21:24631137-24631159 CTGGAAAATTCCCTCTTTCTTGG + Intergenic
1177893408 21:26833695-26833717 GTGCAAGTTTTCTCCTTCCTGGG - Intergenic
1178700656 21:34830939-34830961 GTCGTAATTTCCTCCTTTCTGGG - Intronic
1179604036 21:42500862-42500884 CTGGCATTTTCCTCCTTGCTGGG - Intronic
1180273714 22:10627027-10627049 CTGGAGGTTTCCTCCATTCATGG + Intergenic
1181743268 22:24938219-24938241 ATGCAATTTTCCTCCTGTCTTGG - Exonic
1183555641 22:38524689-38524711 CTTCAAGTGTCCTCCCTTCTAGG + Intronic
1185071175 22:48657296-48657318 CTGGAAGTTTGTGTCTTTCTAGG - Intronic
949136380 3:571691-571713 CTGGAGGTTTCCTCCATTCATGG - Intergenic
949486701 3:4546478-4546500 CTGAATCTTTCCTCCTTTCCAGG + Intronic
949786486 3:7747169-7747191 CTCCAAGATTCCTCCTCTCTAGG + Intergenic
950083837 3:10242426-10242448 CATGAAGTCTCTTCCTTTCTGGG + Exonic
951792728 3:26504344-26504366 CTGGAAGCTTCCTCTTTTCAGGG + Intergenic
951945645 3:28132800-28132822 CTGGAATTGTCCTTCTTTCCAGG - Intergenic
953172263 3:40517887-40517909 CTGGAAGTTTGCACCCTACTAGG - Exonic
953200964 3:40778208-40778230 CTGGAAGTTTCTGCCTTTGTTGG - Intergenic
953609543 3:44436173-44436195 CTGGAGCTTTCCTACTTACTCGG + Intergenic
955454627 3:59106134-59106156 CTGAAAGTTTCATCCCTTTTTGG - Intergenic
956442106 3:69290540-69290562 GTGGCTGTTTCCTGCTTTCTTGG + Intronic
956515985 3:70048521-70048543 GAGGAAGTTTCATCCTTTATAGG + Intergenic
956939043 3:74136019-74136041 CTGGAAGTCCCCTCCTGGCTAGG + Intergenic
957067643 3:75538817-75538839 CTGGAACTTTCTTCCTCTGTGGG + Intergenic
958486962 3:94725080-94725102 TTTGAAGTTGCCTCCTTTCTGGG + Intergenic
958699363 3:97568464-97568486 CTGGCACTTGCTTCCTTTCTAGG + Intronic
959365246 3:105450047-105450069 CTGTATGTTTACTACTTTCTGGG + Intronic
959773301 3:110125744-110125766 CTGGAAGCTCCCTCCTCTCTTGG + Intergenic
959933458 3:112006538-112006560 CTGGATTTTTCCATCTTTCTTGG - Intronic
961360284 3:126362991-126363013 CTGGAATTTTATTCCTTTGTAGG + Intergenic
961649408 3:128409997-128410019 CTGGAGGTCTGCTCCCTTCTTGG - Intergenic
962326223 3:134434840-134434862 CTTGAACATTCCTCCTTCCTTGG + Intergenic
962417751 3:135198944-135198966 CTGGACCTTTCCTCATTTCTTGG + Intronic
964649064 3:158991269-158991291 CTGCCAGATTCCTCCTCTCTGGG - Intronic
966092780 3:176160002-176160024 CTAGCTGTTTCCTCCTTCCTTGG - Intergenic
966908748 3:184545959-184545981 CTAGAAAATTCCTCCTTTCTTGG - Intronic
967414817 3:189204548-189204570 CTGAGAGTTTCCTTCTTTCCTGG + Intronic
967574654 3:191076455-191076477 CTGGATGTAGCCCCCTTTCTAGG - Intergenic
968426260 4:525482-525504 CTGGAAGTGCCCTCATTACTAGG - Intronic
968962427 4:3752436-3752458 CTGGGGCTTCCCTCCTTTCTGGG + Intergenic
969012219 4:4075383-4075405 CTGGAACTTTCTTCCTCTGTGGG + Intergenic
969741865 4:9034325-9034347 CTGGAACTTTCTTCCTCTGTGGG - Intergenic
970730210 4:19094279-19094301 GTCAAAGTTTTCTCCTTTCTTGG - Intergenic
970843576 4:20507864-20507886 CTGGAAGATTCTTCATGTCTTGG - Intronic
971251467 4:24976303-24976325 CTGCAGGTATCCTCCTTGCTTGG + Intronic
971281890 4:25248410-25248432 CTTGGAGTTTCCTGGTTTCTTGG + Intronic
974333872 4:60514667-60514689 CTGGAAGTTTTCTTTTCTCTTGG - Intergenic
977910393 4:102527992-102528014 CTTGAAGTTTTTTTCTTTCTTGG + Intronic
978347829 4:107789566-107789588 CTGGAAGCTTCCATCTTACTTGG + Intergenic
980169158 4:129266440-129266462 GTGGAAATTGCCTCCTTCCTTGG + Intergenic
981671563 4:147292904-147292926 CTCTAAGATTCCTCCTCTCTGGG + Intergenic
982509394 4:156262404-156262426 CTGGAAGCCTCCTCCCTGCTTGG + Intergenic
986359234 5:6959983-6960005 CCCCATGTTTCCTCCTTTCTTGG + Intergenic
986602620 5:9488235-9488257 CTGGCTCTTTCCTCCTTCCTTGG + Intronic
989271860 5:39543187-39543209 CTGGACATTTCCTCTTTCCTTGG + Intergenic
991151499 5:63376255-63376277 CTCTAGATTTCCTCCTTTCTGGG + Intergenic
991599635 5:68339760-68339782 CTGGAATTTTTTTCCTTCCTTGG - Intergenic
992076022 5:73193354-73193376 CTGGAGGGTTCTTGCTTTCTAGG + Intergenic
992780063 5:80119643-80119665 CTGGAAAAGTCCTCCTCTCTGGG - Intronic
992877436 5:81070589-81070611 CTGGAGGTTTCCAGCTTTGTAGG + Intronic
992896325 5:81248256-81248278 CAGGAAGTATGTTCCTTTCTGGG - Intronic
994958595 5:106567219-106567241 ATGGAACTTTCCTCCTCACTGGG + Intergenic
995111881 5:108437706-108437728 CTGCTAGATTCCTCCTCTCTGGG + Intergenic
995263798 5:110135928-110135950 CTGGATTTAGCCTCCTTTCTAGG + Intergenic
999605260 5:153306939-153306961 CTGTAACATTCCTTCTTTCTGGG - Intergenic
1000261089 5:159589271-159589293 CTGGAAGATCCTTCCCTTCTAGG + Intergenic
1000282204 5:159791884-159791906 CTCTAATTTTCTTCCTTTCTGGG - Intergenic
1000391160 5:160724824-160724846 CTGTAAGTTCCCTCCACTCTGGG + Intronic
1000513970 5:162217658-162217680 CTAGAAGCTTCCTGCATTCTTGG + Intergenic
1001130990 5:169063340-169063362 CTGGAAGTTTCCTTCCTACCAGG + Intronic
1001410990 5:171511575-171511597 CTGGAAAATTTCTTCTTTCTTGG + Intergenic
1001782412 5:174381510-174381532 CTGAAAAATTCCTTCTTTCTTGG + Intergenic
1003550515 6:7098605-7098627 CTGTAAGTTTCCTCCCCTCTGGG + Intergenic
1005233911 6:23737526-23737548 CTTGAAGATTCCATCTTTCTTGG + Intergenic
1008093871 6:47318871-47318893 CCAGAAGCTTCCTTCTTTCTTGG + Intergenic
1008132341 6:47733191-47733213 GGACAAGTTTCCTCCTTTCTTGG + Intergenic
1008775469 6:55032378-55032400 CTGGAGGTTTCCTTCTCCCTTGG + Intergenic
1008854617 6:56067582-56067604 GTAGAAGTTTTCTCCTTTCTGGG - Intronic
1011403713 6:86993152-86993174 CTGAAAGTTTTCTTCTTGCTTGG - Intronic
1011939504 6:92825613-92825635 CTGGAAGGCCCCTCCTCTCTTGG + Intergenic
1014674715 6:124349297-124349319 CGGGAAGTTCCCGCCTTTGTAGG - Intronic
1016651755 6:146469878-146469900 CTGGAAATTTCACCCTTGCTTGG - Intergenic
1017570832 6:155742447-155742469 CGGGAAGGTTCCTTTTTTCTGGG - Intergenic
1017825813 6:158081176-158081198 CAGGAAGTGTCCTCCTTCCAGGG + Exonic
1017959316 6:159208102-159208124 ATGAAAGTTTCCTCCGTTATTGG - Intronic
1019570465 7:1709182-1709204 CTGGAGGATTCCTCCCTGCTGGG - Exonic
1019777676 7:2922262-2922284 GTGGAAGTTTCCTCCTCTCTCGG - Intronic
1019881921 7:3869098-3869120 CTGTTAGTTTCCTCTTTTTTGGG - Intronic
1020224047 7:6265721-6265743 CTGAAAGTTTGCTCTTTCCTCGG - Intronic
1020349442 7:7201903-7201925 CTGGAAGTTTCCTTCTCCTTGGG + Intronic
1021243500 7:18234036-18234058 CTGGACGTTTTCACCTTTGTTGG + Intronic
1022333282 7:29399918-29399940 CTAGAGGTTCCCTCCTCTCTGGG - Intronic
1023282447 7:38585005-38585027 TTGGAAATTGCCACCTTTCTTGG - Intronic
1023595299 7:41823105-41823127 CTGGACGTCTCCTCTGTTCTGGG + Intergenic
1024048021 7:45598270-45598292 ATGGCTGTTTCCTCCTTTCGTGG + Intronic
1024328013 7:48127587-48127609 TTGGTTGTTTTCTCCTTTCTTGG + Intergenic
1024482931 7:49884022-49884044 CTGGGAGTTGCCTCCTACCTTGG - Intronic
1028189714 7:87832015-87832037 CATGACTTTTCCTCCTTTCTTGG + Exonic
1030147826 7:106374356-106374378 CTGGTAGTTATCTCCTTTATGGG + Intergenic
1031765815 7:125775710-125775732 CTGAAACTTTCCTCCTTTAGGGG + Intergenic
1033224528 7:139550131-139550153 CTGCAAGTTTCCTACTTTGTGGG - Intergenic
1036253734 8:7187474-7187496 CTGGAACTTTCTTCCTCTGTGGG + Intergenic
1036465276 8:8991709-8991731 GTGGAATCTGCCTCCTTTCTTGG - Intergenic
1036887201 8:12567073-12567095 CTGGAACTTTCTTCCTCTGTGGG + Intergenic
1036894796 8:12625174-12625196 CTGGAACTTTCTTCCTCTGTGGG + Intergenic
1037194040 8:16166101-16166123 CTGGATGATTCCTCGTTTCTAGG - Intronic
1037946634 8:22993682-22993704 CTGGGAGCTTCCTCTTCTCTTGG + Intronic
1037961851 8:23103410-23103432 CTGGAACTTCCCTCCCTTCGCGG - Intronic
1039131793 8:34273289-34273311 GTGGCAGTTTTGTCCTTTCTAGG - Intergenic
1042179773 8:66075298-66075320 CTGGAGATTTCTTCCTTTCAAGG + Intronic
1042332856 8:67599415-67599437 CTGGAAGAATCCTCCTCCCTGGG + Intronic
1043395250 8:79829092-79829114 CGGGAAGCTTCCTCTTCTCTAGG - Intergenic
1044045731 8:87429633-87429655 CCTGAAGTTGCCTCCTTTCGGGG - Intronic
1044169556 8:89032354-89032376 CTGGATATTTCCTCCTTTTTTGG - Intergenic
1047378395 8:124328556-124328578 CTGGAATTCTCTTCCTTTCCAGG - Intronic
1049177035 8:141200033-141200055 CTGGGAGATTTCTTCTTTCTGGG - Intergenic
1049816966 8:144608460-144608482 CAGGAAGCTTCCTCCCATCTGGG + Intergenic
1051161132 9:14208672-14208694 CTGGAAGTTTCCCTCATTTTAGG + Intronic
1051614901 9:18997743-18997765 CTGGAAGCTTCATCCTTGATCGG - Intronic
1053005195 9:34599629-34599651 CTGGAAGCTCTCTCCTTGCTTGG + Intergenic
1053463633 9:38289392-38289414 CTTCAAGTTTCCTCCTTAATAGG - Intergenic
1053604737 9:39645651-39645673 CTTGAAGTTTCTTCCTCCCTGGG - Intergenic
1053862552 9:42401662-42401684 CTTGAAGTTTCTTCCTCCCTGGG - Intergenic
1054248805 9:62696765-62696787 CTTGAAGTTTCTTCCTCCCTGGG + Intergenic
1054562917 9:66731291-66731313 CTTGAAGTTTCTTCCTCCCTGGG + Intergenic
1056821291 9:89843928-89843950 CTGGCAGGCTCTTCCTTTCTGGG + Intergenic
1057922378 9:99107540-99107562 TTGAATGTCTCCTCCTTTCTTGG + Intronic
1058252152 9:102712568-102712590 CTGGCCGTTTCCTCCATTCGGGG - Intergenic
1058642903 9:107104552-107104574 CTTGGTGTTTCCTCCTTTATGGG - Intergenic
1060336564 9:122729232-122729254 CTTGAAGCTTCCTCTTTTCTTGG - Intergenic
1060867992 9:127015035-127015057 CTGCATGTTTCCTACATTCTAGG - Intronic
1061008528 9:127942099-127942121 CTGGAAGCATCCCCCGTTCTGGG - Exonic
1061880732 9:133567679-133567701 CTGCACGTTTGCTCCTTTCTGGG + Intronic
1203620900 Un_KI270749v1:128718-128740 CTGGAGGTTTCCTCCATTCATGG + Intergenic
1185678199 X:1865879-1865901 CTTGAATTTTCCTCCTTGCTTGG - Intergenic
1185949996 X:4422237-4422259 CTGGCAGTTTCCTCATTTTCTGG + Intergenic
1187311437 X:18147481-18147503 CTAGGAGCTTTCTCCTTTCTAGG + Intergenic
1187757463 X:22543628-22543650 CTGAATGTTTCCTCCCCTCTAGG - Intergenic
1188338176 X:28964710-28964732 CTGGATTTTTTCTCATTTCTTGG + Intronic
1188577083 X:31664463-31664485 CTCGAAGTTCTCTGCTTTCTTGG + Intronic
1188956119 X:36436512-36436534 ATGCAAGTTTTCTTCTTTCTGGG - Intergenic
1189266390 X:39719975-39719997 CTTGAATTTTCATCCTCTCTTGG - Intergenic
1190172354 X:48121702-48121724 ATGGTAGTTTCCTCCTTCCAAGG - Intergenic
1193911755 X:87315024-87315046 CTGGAAGCTCCCTCCCTACTTGG + Intergenic
1195111728 X:101657068-101657090 CTGGAAGTCTCCGCTTCTCTGGG + Exonic
1196500105 X:116370993-116371015 CTGACATTTTCCTCCTTCCTAGG - Intergenic
1197213994 X:123851194-123851216 CTGGAAGCTTCCTCATTTCCTGG + Intergenic
1197908474 X:131453082-131453104 TTAGAAGTTTTCTCTTTTCTTGG + Intergenic
1198451441 X:136769776-136769798 ATGGAAGAATCCTCCTGTCTAGG - Intronic
1199829235 X:151532430-151532452 CTGGCAGTTTCCTTCCTTATGGG + Intergenic
1201264430 Y:12192449-12192471 CTGAATGTGTCCTCCTTTTTGGG - Intergenic
1201387134 Y:13453798-13453820 CTGGAAGTCTCCTCCTTCAATGG + Intronic
1202024879 Y:20511031-20511053 CTTGAAGCTTCCTTCCTTCTTGG - Intergenic