ID: 1063391619

View in Genome Browser
Species Human (GRCh38)
Location 10:5653231-5653253
Sequence GCCCCTTGTAGGCCTTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063391619 Original CRISPR GCCCCTTGTAGGCCTTGCCC AGG (reversed) Intronic
900173452 1:1281624-1281646 AGCCCTTAGAGGCCTTGCCCGGG + Intronic
900607262 1:3529392-3529414 GCCCCGTGTGGGGCTTGGCCTGG - Intronic
901656814 1:10774099-10774121 GCCCCTTGTGGGCCTGGCGGTGG - Intronic
903182415 1:21611620-21611642 GCCCCATGGAGGCCTGGCCAGGG - Intronic
905800078 1:40837707-40837729 GCCCCTTGTCGCCCTTCTCCCGG - Exonic
906715361 1:47964864-47964886 ACCCCTTGGAAGCCCTGCCCAGG + Intronic
906785384 1:48611011-48611033 GACCCTAGAAGGCCCTGCCCTGG - Intronic
912312937 1:108641282-108641304 GCCCCTTTTTGGGCTGGCCCAGG - Intronic
912682254 1:111736845-111736867 GCCCTTTGGCTGCCTTGCCCAGG - Intronic
921068510 1:211639816-211639838 GCCCCTTGTCAGCCATGGCCAGG - Intergenic
922959786 1:229636509-229636531 GCCCCTTATAGGTGTTGCTCTGG + Exonic
923630112 1:235644244-235644266 GACCCACGAAGGCCTTGCCCTGG + Intronic
923676784 1:236087415-236087437 GCCCCTTGTAAGCACAGCCCTGG - Intergenic
924602477 1:245503880-245503902 TACCCTGGTAGGCCTTTCCCAGG + Intronic
1063391619 10:5653231-5653253 GCCCCTTGTAGGCCTTGCCCAGG - Intronic
1067836208 10:49643452-49643474 GCCCCGGGGAGGCCTTGGCCAGG - Intronic
1069898785 10:71695348-71695370 TCCCCTGGCAGGCCCTGCCCTGG + Intronic
1069955975 10:72052119-72052141 GCTCCTTGATGGCCTTGCACAGG - Intergenic
1070150559 10:73802375-73802397 CCCCCTTGTGGGCCCTGCTCTGG + Exonic
1071422664 10:85516212-85516234 TCCCCTAATAAGCCTTGCCCTGG - Intergenic
1077109543 11:856026-856048 GCCTCCTGTAGGCCTTGGGCAGG - Intronic
1077347946 11:2072994-2073016 GCCCCTTGTACTCCTTGGCTAGG - Intergenic
1084380027 11:68805865-68805887 GCCCATTGTAGTCATGGCCCTGG - Intronic
1084977518 11:72810754-72810776 CCACCTTGGAGGCTTTGCCCTGG - Intergenic
1088640760 11:111871089-111871111 GCCCACTCTAGGCCTGGCCCAGG + Intronic
1089169004 11:116499671-116499693 GCCCCTTGCATGCCCTGCACAGG - Intergenic
1089671818 11:120062126-120062148 GCCCCCTGATGGCCCTGCCCTGG - Intergenic
1089775250 11:120831353-120831375 GCCTCTTGTAATCCTTGCCTTGG + Intronic
1096798350 12:54092508-54092530 GCCCTCTGTGGGCCTTTCCCTGG - Intergenic
1102466744 12:113134817-113134839 GCCTCGTGTGGGCCTTCCCCGGG - Intronic
1105330701 13:19412697-19412719 GCTCCTTGTGGGCTCTGCCCTGG - Intergenic
1105805744 13:23950844-23950866 GCCCCTTCCAGGCCAGGCCCAGG + Intergenic
1105918775 13:24941471-24941493 GCTCCTTGTGGGCTCTGCCCTGG - Intergenic
1108367997 13:49736560-49736582 ATCCCTTGTATGCTTTGCCCAGG + Intronic
1108699665 13:52933109-52933131 GCCCCTTCGAGCCCTTCCCCAGG + Intergenic
1109062903 13:57641672-57641694 GGTATTTGTAGGCCTTGCCCTGG + Intronic
1113150192 13:107254618-107254640 CCCACTTGTAAGCCTTGCCCTGG + Intronic
1114398144 14:22385258-22385280 GTCCATAGTAGGCATTGCCCAGG - Intergenic
1117803496 14:59467362-59467384 GGGCCTTGTAGGCCATGCTCTGG + Intronic
1119851649 14:77870736-77870758 GGCTCTTGAAGGACTTGCCCTGG + Intronic
1121450079 14:94001401-94001423 GCTCCCTCTAGGCCTTCCCCAGG - Intergenic
1202850597 14_GL000225v1_random:15542-15564 GCCCCCTGTAGGCAAAGCCCAGG + Intergenic
1127619036 15:60715207-60715229 GCTCCTTGTAGGTCTTCCCATGG - Intronic
1131143129 15:89993745-89993767 GCTCCTTGAAGGCCTGGCCTAGG + Intergenic
1131827630 15:96333389-96333411 GGCCCTTACAGGCCCTGCCCAGG + Intronic
1132669103 16:1095427-1095449 GGCCCCTGCAGGCCCTGCCCTGG - Intronic
1137009203 16:35306810-35306832 GCCCCTTGTGGGCTGAGCCCAGG + Intergenic
1138687616 16:58739260-58739282 GCCCCTTCTGGCCATTGCCCTGG + Intergenic
1139960846 16:70716469-70716491 GGCCCATGTTGGCCTGGCCCAGG + Intronic
1141443278 16:84042852-84042874 GCCCCCTGCAGGCCCGGCCCCGG + Intergenic
1142572012 17:880912-880934 GCCCCTTGGAGCCCTGGCCCAGG - Intronic
1143007290 17:3845619-3845641 TCTCCTTGTGGGTCTTGCCCCGG - Intronic
1144621957 17:16823641-16823663 GCCCCTTGTGGAACTGGCCCAGG + Intergenic
1144884466 17:18449073-18449095 GCCCCTTGTGGAACTGGCCCAGG - Intergenic
1145147763 17:20495304-20495326 GCCCCTTGTGGAACTGGCCCAGG + Intergenic
1146517464 17:33500452-33500474 GCAGCTTGTAGGCCTGTCCCAGG - Intronic
1147573927 17:41587975-41587997 GCCCCTTGTGGAACTGGCCCAGG + Intergenic
1147628961 17:41918146-41918168 GCCCCTTGAGGACCTTTCCCCGG + Intronic
1149610088 17:57953694-57953716 GGCCCTAGTTGGCCTGGCCCAGG + Intronic
1152068134 17:78122547-78122569 GCTCCCTGCAGGCCTGGCCCTGG - Intronic
1158535166 18:58301959-58301981 TCCCCTTGTTGCCCCTGCCCCGG + Intronic
1160878188 19:1307526-1307548 CCCCCTTCTTGGCCTTGCGCAGG + Intergenic
1161976723 19:7611557-7611579 GCCGGTTCCAGGCCTTGCCCAGG - Exonic
1162573691 19:11486724-11486746 GGGCCTTGTGGGCCTGGCCCAGG + Intronic
1163369188 19:16892575-16892597 GCCGGTTGTAAGCCTTGCACGGG + Exonic
1164129715 19:22350538-22350560 GCCCCTTGTAGACAGGGCCCTGG - Intergenic
1164169833 19:22715488-22715510 GCCCCTTGTAGACAGGGCCCTGG + Intergenic
1166403135 19:42498796-42498818 GCCCATAGTAGGCCTTGATCAGG - Intergenic
1166415590 19:42593055-42593077 GCTCCTAGTTGGCCCTGCCCAGG + Intronic
1166554816 19:43691511-43691533 GCCCCTTGTAGCCTGTTCCCAGG + Intergenic
1167485584 19:49761260-49761282 GCCTGTTTTAGGCCTGGCCCAGG + Intronic
1167896618 19:52586932-52586954 GTCCCCTGCAGGCCTCGCCCCGG + Exonic
1168153433 19:54460850-54460872 GGCCCGTGTAGGCCAGGCCCAGG - Exonic
926133095 2:10317783-10317805 GACCATTGGAGGCCCTGCCCTGG + Intronic
927126016 2:20012761-20012783 GCTCCTTGTTGGCCTTGGGCGGG - Intergenic
927388569 2:22565383-22565405 TCCTCCTGTAGGCCTTGCACAGG - Intergenic
928338706 2:30422608-30422630 ACCCCTTCTAAGCCTCGCCCAGG + Intergenic
929799192 2:45084995-45085017 GCCCCGCCTAGGCCCTGCCCTGG - Intergenic
929872924 2:45773668-45773690 TCCCCAAGTAGGCCTTGGCCTGG + Intronic
932769465 2:74492418-74492440 GTCCCATCAAGGCCTTGCCCAGG - Exonic
934937776 2:98477762-98477784 GCCCTGTGTGGGTCTTGCCCAGG + Intronic
934941311 2:98504536-98504558 GCCACTTGGAGGCCTTGGGCAGG + Intronic
935586046 2:104801152-104801174 CACCCATGTAGCCCTTGCCCTGG + Intergenic
937915240 2:127095658-127095680 GCCCCAAGTTGGCCTTTCCCAGG - Intronic
940598527 2:155826595-155826617 GCCCCCAGTTGCCCTTGCCCTGG - Intergenic
946258973 2:218469271-218469293 GCCCCTTCTAGGCCATGGCAAGG - Intronic
947707022 2:232284645-232284667 GCCCCATGTGGTCTTTGCCCCGG + Intronic
1169211045 20:3766588-3766610 GCCCCACCTAGGCCCTGCCCTGG + Intronic
1170412636 20:16107602-16107624 GCCCCTTGTTGGCCTCGTTCTGG - Intergenic
1171782959 20:29437816-29437838 GCCCCTTGTAGGCAGGGCCCAGG + Intergenic
1171798060 20:29581833-29581855 GCCCTCTGTGGGCCTTTCCCTGG + Intergenic
1171850183 20:30302328-30302350 GCCCTCTGTTGGCCTTTCCCTGG - Intergenic
1173055124 20:39604522-39604544 CACCCATGTAGGCTTTGCCCAGG - Intergenic
1173288872 20:41696911-41696933 GGCCCTTGAAGACCTAGCCCAGG - Intergenic
1173998815 20:47359449-47359471 GCCCTTCGTAGGCCTGCCCCAGG - Intergenic
1174087021 20:48016622-48016644 GGCCTTTGGAGGACTTGCCCTGG - Intergenic
1175971552 20:62689160-62689182 GCGCCTCGTAGGCCTGTCCCTGG + Intergenic
1180564188 22:16649150-16649172 GCTCCTTGTGGGCTCTGCCCTGG + Intergenic
1181566394 22:23741360-23741382 GCCACTTGCAGGCAATGCCCAGG + Intergenic
1183482252 22:38071603-38071625 GGCAATTGGAGGCCTTGCCCTGG + Intronic
1184235683 22:43181900-43181922 ACCCCTTGTTGCACTTGCCCAGG - Intronic
950263469 3:11558759-11558781 GCTCCTTGTAATTCTTGCCCAGG + Exonic
950940432 3:16885242-16885264 TCCCCTGGTAGGGCTAGCCCGGG - Intronic
953528332 3:43714077-43714099 TTCCCTTGTGGGCCTTGCCCTGG + Intronic
953773670 3:45797766-45797788 GCTCCTTGTTGGGCTTTCCCTGG + Intergenic
953931784 3:47009349-47009371 GCCCCCGGCAGGCCTGGCCCGGG + Exonic
957082526 3:75648776-75648798 GCCCCTTGTAGGCAGGGCCCAGG - Intergenic
960140062 3:114142961-114142983 GCCCCCAGCAGGCCTGGCCCTGG + Intronic
960577953 3:119245701-119245723 GGCCATGGCAGGCCTTGCCCAGG + Intergenic
963311184 3:143711891-143711913 GCCCCATGTAGCTCTAGCCCTGG - Intronic
964682404 3:159356851-159356873 GCCCCTTTTATGCCTTGCAGAGG + Intronic
971909095 4:32771539-32771561 GCCCCTTAAAAGCCTTGGCCTGG + Intergenic
978310705 4:107382397-107382419 GCCCCTTGAAAGCCTTGCTTAGG - Intergenic
982266874 4:153545907-153545929 GCCCCTTTTATGTGTTGCCCAGG + Intronic
985838554 5:2288825-2288847 GCCCCTTGATGGTCTGGCCCTGG - Intergenic
992226547 5:74624581-74624603 GCCGCTGGTGAGCCTTGCCCTGG - Intergenic
995960695 5:117835206-117835228 GACGCTTGGAGGCCTTGGCCAGG + Intergenic
997309285 5:132866480-132866502 GTGCCTTGGAGGCCCTGCCCGGG - Intronic
997418076 5:133744488-133744510 TCCCTTTGTAGGTCCTGCCCTGG + Intergenic
997624967 5:135325273-135325295 GCCCCTTGCAGGCCTGGCTAGGG + Intronic
997699302 5:135885266-135885288 GCCCATTGTATGCCTGGCACTGG - Intronic
998208160 5:140174505-140174527 GCTCATTCTAGGCCTTGCTCTGG + Intergenic
1001487194 5:172128081-172128103 GCCCCTTGAGGGCCTAGACCTGG - Intronic
1002311810 5:178319618-178319640 GACCCTTGCAGGCCTTGGACAGG + Intronic
1002699095 5:181109915-181109937 CCCCTCTGTAGGCATTGCCCTGG - Intergenic
1003783468 6:9456302-9456324 GCCCCTTGTTGGCCAGGCCTGGG + Intergenic
1007095468 6:39210174-39210196 GCCACTTGTCAGACTTGCCCAGG + Intronic
1016614218 6:146028353-146028375 GTCCCTTGCAGGCCCTGCCAGGG + Intronic
1016862108 6:148731093-148731115 GCCCCTTCCAGGCCTTGCACCGG - Intergenic
1019461685 7:1162446-1162468 TCCCCTTGAAGGCTCTGCCCAGG + Intergenic
1019510025 7:1413110-1413132 GCCCCTTGTAGGCGTGACCGAGG + Intergenic
1019545170 7:1570617-1570639 CCCCCTTCTTGGCCTTGGCCGGG - Intronic
1020258084 7:6513698-6513720 GCCACGTGTGGGCCTAGCCCTGG + Intronic
1020643674 7:10787229-10787251 GCCCCTTGGAGGCCCAGGCCTGG - Intergenic
1023929662 7:44697593-44697615 GTCCCTTGTAGGCTTTGAGCTGG + Exonic
1025157209 7:56617938-56617960 GCCCCTTGTGGGCAGTGTCCAGG + Intergenic
1025722402 7:64028476-64028498 CCCCCTTGTAGGCAGTACCCTGG + Intergenic
1026593718 7:71716862-71716884 GCCCCTTGCAAGCCTTTTCCTGG - Intergenic
1029872414 7:103708819-103708841 GCCCCTCAGAGGCCTTACCCTGG + Intronic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1034411630 7:150945284-150945306 TCCCCTTGGAGGCCCTGCTCAGG - Exonic
1035652826 8:1281731-1281753 GCTCCTTGAAAGCCTTCCCCGGG + Intergenic
1036656809 8:10682137-10682159 GGTCCTTGGAGGCCTTTCCCAGG - Intronic
1040374734 8:46813985-46814007 GCCCCTTGTAGGAAGTGTCCAGG - Intergenic
1040375198 8:46818060-46818082 GCCCCTTGTGGGCAGTGTCCAGG - Intergenic
1040379807 8:46861434-46861456 GCCCCTTGGGGGCCGTGTCCAGG - Intergenic
1043769842 8:84184433-84184455 TCCCCTTGGAGGCGTTTCCCGGG + Intronic
1048289186 8:133167164-133167186 GCCCCTCGTACGTCCTGCCCAGG + Intergenic
1053787956 9:41665621-41665643 GCCCTCTGTGGGCCTTTCCCTGG - Intergenic
1054157175 9:61649147-61649169 GCCCTCTGTGGGCCTTTCCCTGG + Intergenic
1054176232 9:61876963-61876985 GCCCTCTGTGGGCCTTTCCCTGG - Intergenic
1054476950 9:65580152-65580174 GCCCTCTGTGGGCCTTTCCCTGG + Intergenic
1054661307 9:67703845-67703867 GCCCTCTGTGGGCCTTTCCCTGG + Intergenic
1056214315 9:84393436-84393458 GCCCCTTGCAGACCTTGCGGAGG - Intergenic
1056820665 9:89839843-89839865 GCCCATTGTAGGCCCTGTGCTGG + Intergenic
1057294728 9:93828345-93828367 GCCCCTGGCAGGCCTTGGCAGGG + Intergenic
1057769513 9:97955161-97955183 TCCTCTTGTTGGCTTTGCCCAGG - Intergenic
1059665574 9:116443368-116443390 GAACCTTGTAGGCCATGCCAGGG + Intronic
1060727621 9:126016652-126016674 GGCCCTGCTAGGCCTGGCCCTGG + Intergenic
1060813636 9:126623770-126623792 GCCCCCTGTAGGGCCAGCCCTGG + Intronic
1061758643 9:132834139-132834161 GCCTCTTGTGAGGCTTGCCCTGG - Intronic
1062598978 9:137311671-137311693 GGCCCTGGGAGGCCCTGCCCCGG + Intronic
1203442978 Un_GL000219v1:28651-28673 GCCCCTTGCAGGCAGGGCCCAGG + Intergenic
1203513786 Un_KI270741v1:147560-147582 GCCCCTTGCAGGCAGGGCCCAGG + Intergenic
1185454542 X:302072-302094 GCCCCTTGAAGGCTGTGGCCTGG + Exonic
1192154394 X:68733073-68733095 CCCCCTTGTGGGCCCTGCCAGGG - Intergenic
1192550056 X:72046355-72046377 GCCACTTGCAGCCCTTGGCCTGG - Intergenic
1198417320 X:136433877-136433899 GGCTCTTGTTGGCCTTTCCCAGG + Intergenic
1200858956 Y:7969632-7969654 GTCCCTTGTAGGCAGTGTCCAGG + Intergenic
1200890081 Y:8313869-8313891 ACCCCTTGTAGGCAGTGTCCAGG - Intergenic