ID: 1063395923

View in Genome Browser
Species Human (GRCh38)
Location 10:5687335-5687357
Sequence CTAGTTAAGGATATCTATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063395923 Original CRISPR CTAGTTAAGGATATCTATAT AGG (reversed) Intronic
909618962 1:77646075-77646097 CTAGTTTAGGATTTCTAAAAGGG - Intronic
911686623 1:100784432-100784454 TTAGTTATGGATATATATGTGGG - Intergenic
912154311 1:106898524-106898546 CCAGCTAAGGATATGTGTATGGG - Intergenic
914264144 1:146023223-146023245 ATAGATATGGATATCTATATAGG + Intergenic
917421394 1:174867488-174867510 CTATTTCAGGATTTCTAAATGGG + Intronic
919219775 1:194612164-194612186 CTATTTAAGGATATATGAATAGG - Intergenic
919673621 1:200360339-200360361 CTAGTAAGGGAGATCTATTTGGG - Intergenic
920861707 1:209713894-209713916 CTACTTATGGAAATCAATATAGG - Intronic
922558951 1:226553839-226553861 CTACTTAAGAATAGCTATAAAGG + Intronic
922921864 1:229312155-229312177 CCAGTTAAGGATGACTATTTTGG - Intergenic
1063395923 10:5687335-5687357 CTAGTTAAGGATATCTATATAGG - Intronic
1068246534 10:54378227-54378249 TTTATTAAGAATATCTATATTGG - Intronic
1079526792 11:21399971-21399993 CTAGTTTAGGATCTATAGATGGG + Intronic
1090456420 11:126853881-126853903 CTAGTTAATGATATTAATAGTGG + Intronic
1091203409 11:133800352-133800374 CTAGATGAGGATATCTTTAAAGG + Intergenic
1092943818 12:13434954-13434976 CCATTTAAGGACATTTATATAGG - Intergenic
1093271029 12:17062166-17062188 CTTGTTAAGGATATCCTTACTGG - Intergenic
1097698877 12:62800686-62800708 ATATTTAAGGATATTTATAAGGG - Intronic
1099484679 12:83214105-83214127 CTGGTAAACAATATCTATATTGG - Intergenic
1101831416 12:108260153-108260175 CTATTTAAGGAAATCTTTGTTGG + Intergenic
1102814328 12:115851531-115851553 TAAGTTATGCATATCTATATGGG - Intergenic
1107563240 13:41576573-41576595 CAAGTTCAGCATATCTATAATGG - Intronic
1107816276 13:44247448-44247470 CTAGTTAATGTTACCTATTTTGG + Intergenic
1110929329 13:81195312-81195334 CCAGTTTTGGATATCTTTATTGG - Intergenic
1114165614 14:20215658-20215680 CTATTTGAGGATATATATTTGGG + Intergenic
1114928700 14:27439091-27439113 CTAGTTAAGCATTTTTATAAAGG - Intergenic
1115967279 14:38904963-38904985 TAAGTTAAGGATATCAAGATGGG - Intergenic
1118128735 14:62938292-62938314 GTAGGTAAGGAGATCTTTATGGG - Intronic
1120308563 14:82801748-82801770 CTAGTTAAGGAATTCTGAATAGG - Intergenic
1120549625 14:85853904-85853926 CTAGATACAGATATCGATATAGG + Intergenic
1121878529 14:97477787-97477809 CTAGATAATGATTACTATATGGG - Intergenic
1127251042 15:57238694-57238716 CAAGTTAAAAATATATATATTGG + Intronic
1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG + Intronic
1127925135 15:63531892-63531914 CTACTCAAGGTTATCTACATTGG - Intronic
1128273482 15:66333000-66333022 CTAGGTAAGAATATCCATACAGG + Exonic
1139615726 16:68088833-68088855 CTATTTAAAAATATATATATTGG - Intronic
1149163603 17:53724518-53724540 TTATTTAAGGATATATATGTGGG - Intergenic
1151096418 17:71504059-71504081 CTACTTAATGATATGTAGATAGG - Intergenic
1157377647 18:47181186-47181208 CTATTTTAGGATTTCTACATTGG + Intergenic
1158921592 18:62197567-62197589 CAAACTAAGGAAATCTATATAGG + Intronic
928038224 2:27846665-27846687 CTAGGTAAGTATATGTAAATAGG - Intronic
928889169 2:36182076-36182098 CTAGATATAGATATATATATAGG + Intergenic
929098542 2:38286732-38286754 GTAGCTAAGGATATTTATAAAGG + Intergenic
930342185 2:50130983-50131005 TTACTTAAGTATATCTTTATTGG + Intronic
930443729 2:51443686-51443708 TTAATTCAGGATATGTATATTGG + Intergenic
931578577 2:63747496-63747518 CTGGATAAAGATATCCATATGGG - Intronic
932037420 2:68260396-68260418 CTTGTCAAAGATATATATATCGG - Intronic
935418737 2:102845027-102845049 ATATTTCAGGATATGTATATGGG + Intergenic
938650062 2:133373766-133373788 CAAGTTAACTATATTTATATGGG - Intronic
940340455 2:152575650-152575672 CTAGGTAAGTTTATCTCTATAGG - Intronic
942408799 2:175684849-175684871 CCAGTTAAGGGCATCTATAGTGG + Intergenic
942568909 2:177293770-177293792 CAAGTTTAGGATAACTATATTGG - Intronic
944753462 2:202735148-202735170 CTAGTTAAGGTTATTTAGTTGGG + Intronic
945182779 2:207108786-207108808 CCAGTTGAGGATATTTATAATGG - Intronic
945800996 2:214430587-214430609 CTAGTTTATTATATCTACATGGG + Intronic
945825471 2:214716246-214716268 CTATTTAAGCACACCTATATAGG - Intergenic
946290602 2:218741685-218741707 CTACTTCAGGTTATATATATTGG + Intronic
947955017 2:234181912-234181934 CTAGTTAAGGAATACTATATGGG - Intergenic
1170530073 20:17282119-17282141 GCAGTTAAGGATGTCTATATAGG + Intronic
1172472781 20:35212741-35212763 CTATGCAAGGATATCTATCTAGG + Intergenic
1175149347 20:56920961-56920983 CAAGTTAAGGATCTTAATATGGG - Intergenic
1176674463 21:9765329-9765351 ATATTTAAGGTTATCTATAAAGG - Intergenic
1176674473 21:9765426-9765448 ATATTTAAGGTTATCTATAAAGG - Intergenic
1177851663 21:26356298-26356320 CTAGATAAGAATATTTAAATTGG - Intergenic
1178700975 21:34834124-34834146 CTGGGTATGGATATCCATATTGG - Intronic
1180017991 21:45099945-45099967 CTATCTAAAGATATTTATATGGG + Intronic
1182069093 22:27450840-27450862 GTAGTTAAGGATTTCAATACGGG + Intergenic
1183555737 22:38525393-38525415 CTTGTTTAGGTTATCTATAATGG - Intronic
951448308 3:22807784-22807806 CTGGTTAAGGAGAGCTATAAGGG - Intergenic
951724570 3:25742929-25742951 AAAGTTAAGGATCTCTAGATGGG + Intronic
952334769 3:32394144-32394166 CTAGTTAGGGCTATCTACTTGGG + Intronic
952628172 3:35432270-35432292 CCAGTTGAATATATCTATATGGG + Intergenic
953953865 3:47215181-47215203 CTGGTTAAGGAAATATTTATAGG + Intergenic
955545443 3:60023739-60023761 CTAGTTGAGCCTATCTATAAAGG - Intronic
957269772 3:78014471-78014493 CTAGTTAATGGTTTTTATATGGG - Intergenic
958031825 3:88120024-88120046 CTATTTAAGGATATCCTTTTTGG - Intronic
960915574 3:122690987-122691009 CATATTAAGGATATTTATATTGG + Intronic
961941672 3:130644618-130644640 ATAGTTATAGATATCTACATGGG + Intronic
964204292 3:154154569-154154591 TTATTTAAGAGTATCTATATGGG - Intronic
967319760 3:188183924-188183946 CTAGTTCAGTCTATCTCTATGGG - Intronic
972065504 4:34938835-34938857 CTGGTTCAGGATACCTACATTGG + Intergenic
975065910 4:70063604-70063626 CTCATTAAGGAAATGTATATGGG - Intergenic
975188284 4:71429183-71429205 ATATTTTAGGTTATCTATATGGG - Intronic
976498978 4:85764468-85764490 CTGGTTAATGATATCAATAAAGG - Intronic
977226708 4:94400627-94400649 ATATTTAAGAATATCTATCTAGG + Intergenic
978439146 4:108715457-108715479 CAAGTTAAGGATCTCAAGATGGG + Intergenic
978696137 4:111582808-111582830 ATAGGTAACCATATCTATATTGG + Intergenic
980564675 4:134523876-134523898 CTGGTGAAGGATGTCTATAGTGG + Intergenic
980838653 4:138229616-138229638 CTAGGAAAGGATAACCATATTGG - Intronic
981097587 4:140797831-140797853 CTACTTAAGCATAGCTATGTTGG - Intergenic
985059280 4:186059692-186059714 TTTGTTAAAGATATTTATATCGG + Intergenic
985400833 4:189592086-189592108 ATATTTAAGGTTATCTATAAAGG + Intergenic
985400843 4:189592183-189592205 ATATTTAAGGTTATCTATAAAGG + Intergenic
987466146 5:18274615-18274637 CTAGTTGATGATATCTATCAAGG + Intergenic
987935660 5:24461441-24461463 CTAGTTAATAATATCTAACTGGG - Intergenic
988143458 5:27273092-27273114 CTAGGTACAGATATCTACATTGG + Intergenic
991308479 5:65208457-65208479 CTAGTGAAGGAGATCTTTATGGG + Intronic
993621087 5:90168546-90168568 CTAGTCAAGGATGTCTTTAGAGG + Intergenic
994388906 5:99165900-99165922 CTGGCTAAAGAAATCTATATTGG + Intergenic
994423578 5:99555717-99555739 CTAGTTAAGGATATTTGAGTAGG - Intergenic
994841211 5:104927506-104927528 CTATTTTAGGATATATATTTTGG - Intergenic
995018651 5:107342264-107342286 CTAATCAAGGATATTAATATAGG - Intergenic
1001878491 5:175221757-175221779 CTAGTTAATGATATCTATGCTGG + Intergenic
1008739663 6:54590581-54590603 CTGGTTTAGGATATCCATAGTGG + Intergenic
1012187904 6:96244032-96244054 ATTGTGAAGGATTTCTATATAGG - Intergenic
1012958949 6:105601998-105602020 CTAGGAAAGGATATTTATTTAGG - Intergenic
1015047720 6:128796924-128796946 CTAGGTCAGGATATTTATACTGG + Intergenic
1021132751 7:16930949-16930971 CGAGTTATGTATATCTAGATAGG - Intergenic
1021656314 7:22877803-22877825 CTAGTTAAAGTTATCTCTAAAGG + Intergenic
1021897719 7:25252933-25252955 TGAGTTAAGGATATTGATATGGG + Intergenic
1022825276 7:34004959-34004981 ATATTTAAGGATGTCTATAGGGG - Intronic
1024422029 7:49179478-49179500 CAAGTTAAGAATATTTACATTGG + Intergenic
1024581336 7:50803281-50803303 CTAGTTAAGGACATATGTTTTGG + Intergenic
1025264597 7:57445763-57445785 ATATATAAGGATATATATATAGG + Intergenic
1025601682 7:63005609-63005631 CCAGTTAAGAGTATCTATGTGGG + Intergenic
1027465148 7:78506066-78506088 ATAGTTAAGGAGATCTTTGTGGG - Intronic
1029055592 7:97738102-97738124 TTAGTTAAGGAAATATAAATAGG + Intronic
1031681948 7:124686340-124686362 TAAGTTAAGGATTTCGATATGGG + Intergenic
1031774203 7:125885969-125885991 ATAGTTAATTATTTCTATATAGG - Intergenic
1031823366 7:126532149-126532171 CTGGTAAAGAATATCTGTATAGG - Intronic
1031865373 7:127032950-127032972 CTGATTAAGGATATCTAGAATGG - Intronic
1032459407 7:132098790-132098812 CTAGTTAATGATATCCATGCTGG + Intergenic
1040970670 8:53133969-53133991 CCAGTTAAGGAACTATATATAGG + Intergenic
1041278208 8:56185618-56185640 CTAGAAAAGGATATATATCTAGG + Intronic
1044118373 8:88363213-88363235 CTAATTAAAAATATCTATCTAGG + Intergenic
1044350403 8:91158225-91158247 CAAGTTAAGGATCTCTACAGTGG + Intronic
1044856379 8:96480285-96480307 CTTCTTAGGGATATCTATAGTGG - Intergenic
1046314838 8:112486019-112486041 CTGGCTAAGTATATCTATATAGG + Intronic
1048191061 8:132289623-132289645 CTAGTTAAGGATCTTGAGATGGG - Intronic
1050229221 9:3500971-3500993 ACAGGTATGGATATCTATATTGG + Intronic
1050880885 9:10699413-10699435 TGAGTCAAGGATATTTATATGGG - Intergenic
1051521196 9:17991098-17991120 ATAAGTAAGGATATCTACATAGG - Intergenic
1051556512 9:18389250-18389272 CTTGTCAAGAATATATATATTGG + Intergenic
1055341540 9:75289494-75289516 GTAGATAAGTATATCTATATAGG - Intergenic
1058268515 9:102938074-102938096 GTAATTAAAGATATCCATATAGG - Intergenic
1059792493 9:117655271-117655293 GTAGATACAGATATCTATATAGG - Intergenic
1185813676 X:3133478-3133500 CAAGTTAAGGATCTCAAGATGGG - Intergenic
1186280126 X:7983893-7983915 CTAGTTAGGTATTTCTTTATAGG - Intergenic
1186353272 X:8762124-8762146 CTAGTTAGGTATTTCTTTATAGG + Intergenic
1186620308 X:11233836-11233858 CTAGTTAGGTATTTCTTTATAGG - Intronic
1186946527 X:14574836-14574858 ATAGTTATGGATATTTAAATAGG + Intronic
1191600431 X:62999535-62999557 CTAATTGAGGAGATCTCTATTGG + Intergenic
1192163845 X:68810565-68810587 CAATTTAAGGAGATGTATATGGG + Intergenic
1193106117 X:77675597-77675619 TTACTTAAGTATATCTGTATAGG + Intronic
1200038540 X:153348947-153348969 CTAGTTTTGGATATGTATAGGGG - Exonic