ID: 1063397669

View in Genome Browser
Species Human (GRCh38)
Location 10:5706448-5706470
Sequence GCACAAGCCCAGATTGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063397665_1063397669 14 Left 1063397665 10:5706411-5706433 CCAGCAAAGTTAGAAAGCCAGGC 0: 1
1: 0
2: 1
3: 7
4: 154
Right 1063397669 10:5706448-5706470 GCACAAGCCCAGATTGAAGCTGG No data
1063397663_1063397669 15 Left 1063397663 10:5706410-5706432 CCCAGCAAAGTTAGAAAGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 203
Right 1063397669 10:5706448-5706470 GCACAAGCCCAGATTGAAGCTGG No data
1063397662_1063397669 16 Left 1063397662 10:5706409-5706431 CCCCAGCAAAGTTAGAAAGCCAG 0: 1
1: 0
2: 1
3: 24
4: 242
Right 1063397669 10:5706448-5706470 GCACAAGCCCAGATTGAAGCTGG No data
1063397668_1063397669 -3 Left 1063397668 10:5706428-5706450 CCAGGCAGTAATATCAGAGGGCA 0: 1
1: 0
2: 1
3: 7
4: 101
Right 1063397669 10:5706448-5706470 GCACAAGCCCAGATTGAAGCTGG No data
1063397661_1063397669 17 Left 1063397661 10:5706408-5706430 CCCCCAGCAAAGTTAGAAAGCCA 0: 1
1: 0
2: 0
3: 30
4: 221
Right 1063397669 10:5706448-5706470 GCACAAGCCCAGATTGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063397669 Original CRISPR GCACAAGCCCAGATTGAAGC TGG Intronic
No off target data available for this crispr