ID: 1063403136

View in Genome Browser
Species Human (GRCh38)
Location 10:5767286-5767308
Sequence AAGATGATCTGTAGAACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 433
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 395}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063403136_1063403139 13 Left 1063403136 10:5767286-5767308 CCCTTTGTTCTACAGATCATCTT 0: 1
1: 0
2: 3
3: 34
4: 395
Right 1063403139 10:5767322-5767344 TTTTTTGTGTTTTAACAGTCTGG No data
1063403136_1063403140 27 Left 1063403136 10:5767286-5767308 CCCTTTGTTCTACAGATCATCTT 0: 1
1: 0
2: 3
3: 34
4: 395
Right 1063403140 10:5767336-5767358 ACAGTCTGGCTCTGTCACCCAGG 0: 69
1: 2654
2: 25071
3: 86869
4: 157788

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063403136 Original CRISPR AAGATGATCTGTAGAACAAA GGG (reversed) Intronic
901623482 1:10608318-10608340 AAGATAATCTTTTGAACATAAGG - Intronic
901772884 1:11539675-11539697 AAGAAGAGCTGTACCACAAAAGG - Intergenic
902573397 1:17361227-17361249 AAGATTGTGTGTAGAATAAAGGG + Intronic
905379398 1:37549990-37550012 AAGATGGTCTTTTCAACAAATGG + Intronic
905645722 1:39623907-39623929 AAGAAGACCTTTAGAACAATAGG + Intergenic
905907979 1:41632414-41632436 AAGAGGATATTTAAAACAAAGGG + Intronic
907227076 1:52957880-52957902 AAGATAATCTTTTCAACAAATGG - Intronic
907227087 1:52958011-52958033 AAGATAATCTTTTCAACAAATGG - Intronic
909571647 1:77119013-77119035 AAGAGGATCAGTGGAACACATGG - Intronic
911027565 1:93450277-93450299 AAGATAAACTGTAGAAGAGATGG + Intronic
911286519 1:96000777-96000799 AAGATAATCTCTTTAACAAATGG + Intergenic
911934733 1:103954784-103954806 AAGATTATCTTTTAAACAAATGG - Intergenic
912065891 1:105742117-105742139 AAGAGCATCTGTACAGCAAAAGG + Intergenic
912193277 1:107366468-107366490 AAAATTAACTTTAGAACAAAAGG + Intronic
913199486 1:116484341-116484363 AAGGTGAGCTGGAGAAGAAACGG + Intergenic
915800875 1:158791908-158791930 AAACTGTGCTGTAGAACAAATGG - Intergenic
916226217 1:162492247-162492269 AGGGTGATCTGTATAACCAAGGG - Intergenic
916425014 1:164671894-164671916 AAGAGGGTCTGGAGAAGAAAGGG - Intronic
916697155 1:167250203-167250225 AATATGAGATGAAGAACAAATGG + Intronic
916844402 1:168634317-168634339 AGGATAATCTTTATAACAAATGG + Intergenic
918365347 1:183802176-183802198 AAGATAATCTCTCCAACAAATGG - Intronic
918662246 1:187104003-187104025 AAAATGAGCTGAAGAACAAATGG + Intergenic
919125371 1:193386407-193386429 AAGATAATCTTTTCAACAAATGG - Intergenic
919243711 1:194949590-194949612 AAACTGAACTGTAGACCAAATGG + Intergenic
919370633 1:196721569-196721591 AAATTGGACTGTAGAACAAATGG - Intronic
919417794 1:197332899-197332921 AAGAAGGTCTGTAGAACCAAGGG + Intronic
919483393 1:198117049-198117071 GAGCTGATCTGTAGAAGACAAGG - Intergenic
919556453 1:199060695-199060717 AAAATAATCTGTTCAACAAATGG + Intergenic
920729308 1:208468040-208468062 AGGAGGAGCTGTTGAACAAAAGG - Intergenic
921032788 1:211348715-211348737 AAGATAATCTTTTCAACAAATGG - Intronic
921112187 1:212049517-212049539 ACAATGAGCTGTAGAAGAAAAGG + Intronic
921384722 1:214557185-214557207 ATGATGATGTTTAGATCAAAGGG + Intergenic
923376199 1:233365856-233365878 AAGAAAATCTGTATATCAAAGGG + Intronic
923705709 1:236343025-236343047 AAGATGGTCTGTGGAACAAAGGG - Intergenic
923981708 1:239331662-239331684 AAGATAATCTTTTCAACAAATGG + Intergenic
924122109 1:240811348-240811370 AAGATGATGTTTACAACAGATGG + Intronic
1063267547 10:4471385-4471407 GAGATGATCTTAGGAACAAATGG - Intergenic
1063403136 10:5767286-5767308 AAGATGATCTGTAGAACAAAGGG - Intronic
1063630639 10:7730646-7730668 AAAATTATCTGTTGAACAGATGG - Intronic
1064446833 10:15402015-15402037 AATCTGCACTGTAGAACAAATGG + Intergenic
1065158061 10:22891220-22891242 AAACTGAACTCTAGAACAAATGG - Intergenic
1065714254 10:28549418-28549440 AAGATTATCTATAGAACATTAGG - Intronic
1067978671 10:51056052-51056074 AAGATTATCAGGGGAACAAAAGG + Intronic
1068412180 10:56670456-56670478 AAGATTATGTGTATTACAAAAGG - Intergenic
1069020142 10:63477503-63477525 AGGATGATCTCTTCAACAAATGG + Intergenic
1069602884 10:69720066-69720088 AAGATAATCTTTTCAACAAATGG - Intergenic
1071321020 10:84458077-84458099 AACATGATCTATGGAAAAAATGG - Intronic
1072332304 10:94365614-94365636 AAGAGGATCTGGAGTCCAAATGG - Intergenic
1072509916 10:96111001-96111023 AAGATAGTCAGTAGAACAAAGGG + Intergenic
1073039473 10:100592682-100592704 AAGATGGTCTTTTCAACAAATGG + Intergenic
1075884549 10:125886912-125886934 AAGATAATCACTAGTACAAACGG - Intronic
1076284074 10:129276418-129276440 AACATGATTTGTTTAACAAATGG + Intergenic
1077203884 11:1331390-1331412 AAGATGGTCTTTTCAACAAATGG + Intergenic
1079761923 11:24339502-24339524 AAGAAAATCTGTATATCAAAAGG + Intergenic
1081902994 11:46645855-46645877 AAGTTGAACTGGAAAACAAAAGG - Exonic
1082142150 11:48621764-48621786 AAGATGTTCTGTGGAGCCAATGG + Intergenic
1083003404 11:59318674-59318696 AAGATGTTCTTTGAAACAAATGG - Intergenic
1083916810 11:65751350-65751372 AAGATAGTCTGTGCAACAAATGG - Intergenic
1085747036 11:79123766-79123788 AGGATGAACTGAAGAACAGAGGG + Intronic
1088520931 11:110699416-110699438 AAACTGAACTGTAGACCAAATGG - Intronic
1088872469 11:113902752-113902774 AAAATGTTCTTTATAACAAAAGG + Intergenic
1090219552 11:125006759-125006781 AAGATGGTCTTTTCAACAAATGG - Intronic
1092352874 12:7770137-7770159 AAGATGAACAGGAAAACAAAAGG + Exonic
1092510964 12:9156314-9156336 AAGATGGTCAGTAGGACAAAGGG - Intronic
1092534317 12:9373746-9373768 AAGTTTATCTTTATAACAAAGGG - Intergenic
1092784180 12:12012876-12012898 AAGATGGTCTGGAGATGAAAGGG + Intergenic
1093888429 12:24490164-24490186 AAGCTGAGTTATAGAACAAATGG - Intergenic
1094762367 12:33549156-33549178 AAGATGATTCGGAGAAAAAAGGG - Intergenic
1094791252 12:33918118-33918140 AAGATGTTCTTTGAAACAAATGG - Intergenic
1096680952 12:53255009-53255031 AAGATGATCTCCAGAGCACATGG + Intergenic
1096728257 12:53582988-53583010 AAGATAATCTTTTCAACAAATGG + Intronic
1097338467 12:58410836-58410858 GAGATTATCTGTAAAATAAAAGG - Intergenic
1097703793 12:62846991-62847013 AAGATGATGTCTAGGAGAAAGGG - Intronic
1097989011 12:65814946-65814968 AAGATAATCTTTCCAACAAATGG + Intergenic
1098330737 12:69349912-69349934 AAGATGATTTGCATTACAAAAGG + Intronic
1099542451 12:83929550-83929572 AAGAAGTTGAGTAGAACAAATGG - Intergenic
1099629291 12:85120273-85120295 AAGATGGTCTTTTCAACAAATGG - Intronic
1099870648 12:88345283-88345305 AAGATAATCTATTTAACAAATGG - Intergenic
1101266828 12:103097101-103097123 AATATGATCTGTAGATTAAATGG - Intergenic
1103364578 12:120372031-120372053 AAAATGATCTTTAGAGCAACAGG + Intergenic
1103862190 12:124024319-124024341 AAGATGGTATGAAGAAGAAAGGG - Intronic
1103893706 12:124259194-124259216 AAGATGAACTCTAGCACAAATGG + Intronic
1105551902 13:21405181-21405203 AAGAATTTCTCTAGAACAAAGGG + Intronic
1106269731 13:28140828-28140850 CAGATGTTTTGTAAAACAAATGG + Intronic
1109650411 13:65316638-65316660 AAACTGAACTGTAGACCAAATGG + Intergenic
1110928864 13:81190637-81190659 AAGATGATCTGTAGACACAGTGG + Intergenic
1111035469 13:82667088-82667110 AAGATAATCTGTGGAAATAAAGG + Intergenic
1111976690 13:94973660-94973682 AAGATGACTTGAAGAACTAAAGG - Intergenic
1112025426 13:95406959-95406981 AAGGTGATGTGTAGAAGCAATGG - Intergenic
1112238444 13:97657489-97657511 AAGAAGATGTGCAGAGCAAAAGG + Intergenic
1115607233 14:35015710-35015732 AAGATTATTTTTAGAACAACTGG - Intronic
1116766230 14:49073527-49073549 AATCTGCTCTATAGAACAAATGG + Intergenic
1117145074 14:52829448-52829470 TAGATAATTTGTCGAACAAATGG - Intergenic
1117177129 14:53156228-53156250 AAGATGATCTAGAAAACAAAAGG - Intergenic
1117321909 14:54632559-54632581 AAAGTGAAGTGTAGAACAAATGG - Intronic
1117768155 14:59104621-59104643 AAGATGATCTCTTCCACAAATGG + Intergenic
1118013845 14:61638395-61638417 AACATGCTCTGTAGAGGAAATGG + Intronic
1119249841 14:73142421-73142443 ACCATGATCTCTAGCACAAAGGG - Intronic
1121130645 14:91443192-91443214 AATCTGCACTGTAGAACAAATGG + Intergenic
1202840965 14_GL000009v2_random:120834-120856 AAGAAGATTTGTAGACAAAAGGG - Intergenic
1202873462 14_GL000225v1_random:186972-186994 AAGATAATCACTAGTACAAACGG + Intergenic
1202891446 14_KI270722v1_random:162899-162921 AAAAAGATCTGGAGCACAAAAGG + Intergenic
1123305830 15:18420962-18420984 AAGCTGCTCTGTAGAAAGAAAGG - Intergenic
1123314801 15:18570424-18570446 AAGCTGCTCTGTAGAAAGAAAGG - Intergenic
1123326665 15:18767488-18767510 AAGCTGCTCTGTAGAAAGAAAGG - Intergenic
1123339499 15:18980170-18980192 AAGCTGCTCTGTAAAAAAAAAGG - Intergenic
1123348704 15:19133061-19133083 AAGCTGCTCTGTAGAAAGAAAGG - Intergenic
1123355405 15:19244376-19244398 AAGCTGCTCTGTAGAAAGAAAGG - Intergenic
1123364155 15:19389682-19389704 AAGCTGCTCTGTAGAAAGAAAGG - Intergenic
1123366722 15:19432152-19432174 AAGATGCTCTGTAAAAAGAAAGG - Intergenic
1124713727 15:32037169-32037191 AAGATCATCTTTTCAACAAATGG - Intronic
1125107727 15:35993158-35993180 ATGAAAATCTGTTGAACAAATGG - Intergenic
1125201405 15:37103151-37103173 AAGTTGATCTTTACAAAAAAAGG - Intergenic
1126310901 15:47315334-47315356 AAGATAGTCTGTTCAACAAACGG - Intronic
1127150582 15:56070870-56070892 AAGATAGTCTGTTTAACAAATGG + Intergenic
1128443259 15:67733378-67733400 AAGATGATAAGTAGTAAAAAAGG + Intronic
1128460421 15:67862772-67862794 AATATGATCTGTATACCCAATGG - Intergenic
1129534092 15:76297034-76297056 AAGAGGAACTGTGGATCAAATGG + Intronic
1130334059 15:82943711-82943733 AAGATTACCCGCAGAACAAAAGG + Intronic
1131613956 15:93994125-93994147 AATATGATCTGCAGAGCACAGGG + Intergenic
1132176556 15:99720503-99720525 AAGATGATCTTTCTAATAAATGG - Intronic
1135430175 16:22375655-22375677 AAGATTATCTCTAGAACATGAGG + Intronic
1135774822 16:25248000-25248022 AAGATCATCTTTTCAACAAATGG + Intronic
1135869925 16:26140093-26140115 ATGATGATCTGTGGAGCTAATGG + Intergenic
1135902091 16:26470271-26470293 AAGCTGCACTGTAGCACAAATGG + Intergenic
1136285771 16:29240478-29240500 AAGATGATCTTTTTAACAAACGG - Intergenic
1137628601 16:49925634-49925656 AAGATGGTCTTTTCAACAAATGG + Intergenic
1138005113 16:53327435-53327457 ATGATGTTCTATAGAGCAAATGG + Exonic
1139803259 16:69541829-69541851 AAGATTTTCTGAAGAAAAAATGG - Intergenic
1140464459 16:75168732-75168754 AAGATGAACAGTAGAAAAAAAGG + Intronic
1142091106 16:88210665-88210687 AAGATGATCTTTTTAACAAACGG - Intergenic
1143867725 17:9936048-9936070 CAGATGATCTTTTTAACAAATGG + Intronic
1144407080 17:14962428-14962450 AAGATGATGAGTATACCAAATGG - Intergenic
1144506197 17:15833376-15833398 ACGATGATCTGAAAAACACATGG - Intergenic
1144753427 17:17665740-17665762 AAGATGATTTAAAGAAAAAAAGG + Intergenic
1148401029 17:47361395-47361417 AAGATTTTCTGTAGGATAAAAGG + Exonic
1149496424 17:57121025-57121047 AAGATACACTGGAGAACAAAGGG + Exonic
1149940754 17:60863142-60863164 AAGATCATTTTTGGAACAAATGG - Intronic
1151253475 17:72856110-72856132 AAGTTGAACTGTTGATCAAAGGG + Intronic
1153021027 18:629365-629387 AATATGTTCATTAGAACAAAAGG + Intronic
1153077467 18:1181238-1181260 AAGATAGTCTGTTCAACAAATGG + Intergenic
1153659905 18:7317229-7317251 AAGATGAGCTGGAGCACACAGGG - Intergenic
1153762515 18:8345935-8345957 AAAATTATCTGTATTACAAAGGG + Intronic
1154185509 18:12179393-12179415 CAGATAATCAGGAGAACAAAAGG + Intergenic
1154337716 18:13479022-13479044 AAGATTATCTTTTCAACAAATGG + Intronic
1154406748 18:14098811-14098833 AAGATGCTCTATAGAACACGAGG - Intronic
1155411150 18:25546562-25546584 AATCTGCACTGTAGAACAAATGG + Intergenic
1156211228 18:34945272-34945294 AAGATAGTCTGTTCAACAAATGG + Intergenic
1156256117 18:35398229-35398251 AGGATGCTCTGAAGCACAAAAGG - Intergenic
1156416983 18:36905658-36905680 AAGGTGGTCAGTAGAACAAAGGG - Intronic
1156853741 18:41757580-41757602 AAAATGGTCTATAGACCAAAAGG + Intergenic
1157005747 18:43581864-43581886 AAAATTATCTTTAAAACAAAGGG - Intergenic
1158948769 18:62472393-62472415 AATCTGCACTGTAGAACAAATGG - Intergenic
1159382497 18:67679804-67679826 AAGTTGAACTCTAGAGCAAATGG + Intergenic
1162332808 19:10040722-10040744 CAGATGGTCTGTAAAACACAAGG - Intergenic
1164910319 19:32005906-32005928 AAGATGATCTGAAAAACTACAGG + Intergenic
1165406067 19:35631994-35632016 AAGGTTACCTGAAGAACAAAAGG - Intronic
1166407984 19:42536322-42536344 AATCTGAACTATAGAACAAATGG - Intronic
925730167 2:6914263-6914285 GAGATGATCAGTAGCACAGATGG + Intergenic
926478896 2:13363412-13363434 AATGTGTACTGTAGAACAAATGG + Intergenic
928698985 2:33879870-33879892 AAGCTGATTTGGAGAACAAAGGG + Intergenic
929419660 2:41777822-41777844 AAGGAGGTCTTTAGAACAAAGGG - Intergenic
929690893 2:44072280-44072302 AAGAAAATCAGTATAACAAAGGG + Intergenic
933284148 2:80366504-80366526 AAGATGATCTGTAGGACACCAGG - Intronic
933571030 2:84012405-84012427 AAGATTGTCTTTTGAACAAATGG + Intergenic
935175407 2:100644458-100644480 ACGTTGATCTACAGAACAAAGGG + Intergenic
935192189 2:100787054-100787076 AAGCTGATCTCTAGAAGAGAAGG + Intergenic
936649403 2:114408971-114408993 AAGATCTTCTGTAGAGTAAAAGG - Intergenic
936969401 2:118162880-118162902 AAGATCATCTCTTCAACAAATGG + Intergenic
938424762 2:131176100-131176122 AAGATTGTCTTTACAACAAATGG - Intronic
940163850 2:150745565-150745587 AAGATGGTCTTTTCAACAAATGG + Intergenic
940795695 2:158075250-158075272 AATCTGTACTGTAGAACAAATGG + Intronic
940878884 2:158926035-158926057 AAGATAATCTTTTCAACAAATGG - Intergenic
941472030 2:165899873-165899895 AACATAATCTGTAGAGCAAAGGG + Exonic
942073739 2:172338145-172338167 TAGATTGTCTGTAAAACAAAGGG + Intergenic
942383924 2:175421647-175421669 AAGATGATCTGGTGTACACATGG - Intergenic
942569516 2:177299106-177299128 CAGAGGATTTTTAGAACAAAGGG + Intronic
943708346 2:191060241-191060263 AAGATGCTCTCTGGGACAAAAGG - Intronic
944166686 2:196729743-196729765 AAGATGATCAGTGGAAAAACTGG - Intronic
945268858 2:207918589-207918611 AAGATCATCTGCAGAGGAAAAGG + Intronic
948250604 2:236525619-236525641 AAGATGATGTGGATAACTAATGG - Intergenic
1170940902 20:20847004-20847026 AAGTTGATGTGTAGATCTAAGGG + Intergenic
1170956744 20:20987826-20987848 AAGATAATCTTTTCAACAAATGG + Intergenic
1171254417 20:23678136-23678158 AAGTTGAACTCTAGAGCAAATGG - Intergenic
1171467942 20:25344894-25344916 AAGATGATCTTTTCCACAAATGG + Intronic
1172173031 20:32954368-32954390 AAGATAGTCTCTACAACAAATGG - Intronic
1173031299 20:39363323-39363345 AAGATGACCTGTAGAAAGACAGG + Intergenic
1173715987 20:45206618-45206640 AAGATCATTTTTAAAACAAAAGG + Intergenic
1175375472 20:58520808-58520830 CAGATGGTCTGTAGAAAGAATGG + Intergenic
1176629706 21:9125763-9125785 AAGAAGATTTGTAGACAAAAGGG - Intergenic
1177445707 21:21193011-21193033 AAGTTAATCTGAAGAAGAAAAGG - Intronic
1177669980 21:24212443-24212465 AAGATGATCGGCAGAGCACAAGG + Intergenic
1177783774 21:25647629-25647651 AAAATGATTAGTAAAACAAAGGG + Intronic
1178200230 21:30394841-30394863 ATGATTTTCTGTAGAACAAATGG - Intronic
1178542614 21:33467191-33467213 TATATGATCTGTAGGACAAAAGG - Intronic
1179078394 21:38145705-38145727 AAGATAATCTGTTCAAGAAATGG - Intronic
1179634729 21:42700712-42700734 AAGATCATCTTTTCAACAAATGG - Intronic
1179940147 21:44633225-44633247 AAGATTATATGTAGAATACAGGG - Intronic
1180284631 22:10732554-10732576 AAGATAATCACTAGTACAAACGG - Intergenic
1181962501 22:26632868-26632890 CAAATGATCTGTTGAATAAATGG - Intergenic
949414948 3:3803794-3803816 AAAAAGACCTTTAGAACAAATGG - Intronic
949719142 3:6968241-6968263 AAGATGATGTGAAGAAACAATGG - Intronic
950572588 3:13811267-13811289 CAGAGGATCAGGAGAACAAAAGG - Intergenic
950654526 3:14428305-14428327 AAGATGATCTGTAAAGCACTCGG + Intronic
951629617 3:24705380-24705402 AAGATGTCCAGGAGAACAAATGG + Intergenic
951791301 3:26487792-26487814 AGGAAGATATGAAGAACAAAAGG + Intergenic
951846451 3:27089751-27089773 AATAATATATGTAGAACAAAGGG + Intergenic
952527694 3:34229323-34229345 AAGATAATCTCAAGAATAAAAGG - Intergenic
952567149 3:34672653-34672675 AATCTGAAGTGTAGAACAAATGG + Intergenic
952721554 3:36539172-36539194 AAAATATTCTGTAGAAGAAAGGG - Intronic
953602599 3:44382505-44382527 AAGATAATCTTTTCAACAAATGG + Intronic
954543671 3:51414753-51414775 AAGATCATCTGTAGGATTAAAGG + Exonic
956583191 3:70836501-70836523 AAGAAGAGCAGTAAAACAAAGGG + Intergenic
956658635 3:71578205-71578227 AAGATTATCGGGAGAGCAAAGGG + Intronic
956696667 3:71924346-71924368 AAGATGATCTGCAGAAGGAAGGG - Intergenic
956813009 3:72882972-72882994 AAGATGATCTTTTTAACAAATGG + Intergenic
957089022 3:75709812-75709834 AAAAAGATCTGGAGCACAAAAGG - Intronic
957166938 3:76686593-76686615 AATATGATCTTGAGAACAAATGG - Intronic
957350036 3:79012832-79012854 AAGATGATCTGTAGTGTACAGGG - Intronic
958443703 3:94188778-94188800 AAGATGGTCTTTTCAACAAATGG - Intergenic
959123243 3:102257964-102257986 AAGGAATTCTGTAGAACAAAGGG - Intronic
959244180 3:103842419-103842441 AAGATGGTCTGTTGAATGAATGG - Intergenic
959966584 3:112362558-112362580 AACAATATCTTTAGAACAAAGGG - Intronic
960243538 3:115373901-115373923 AAAATGCTCTATAAAACAAATGG + Intergenic
962068809 3:132011837-132011859 AAGGTTGCCTGTAGAACAAAGGG - Intronic
963201239 3:142588508-142588530 AAAATGATCTGTAGATAAATGGG - Intergenic
963476969 3:145819183-145819205 AAGATAAACTGTAGAACTCATGG - Intergenic
963514849 3:146295649-146295671 AAGCAGTACTGTAGAACAAATGG - Intergenic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
964180030 3:153872701-153872723 AAGACAATCTCTTGAACAAATGG + Intergenic
964466307 3:156997079-156997101 AAGATATTCTGAAGAACAAATGG + Intronic
965113535 3:164458073-164458095 AAGACAATCTTTACAACAAACGG - Intergenic
965258824 3:166452967-166452989 AAAATTATATGTAGAAGAAAGGG + Intergenic
965910502 3:173769375-173769397 GAGATGAAGTGTAGAACAGAAGG - Intronic
967022995 3:185539349-185539371 AAAAAGATCTGTAAAATAAAGGG - Intronic
967502412 3:190214111-190214133 AATATGATTTGTATAAGAAATGG + Intergenic
967764696 3:193266024-193266046 AAGATGTGCTGTACAACATAGGG + Intronic
970111143 4:12639385-12639407 AAAACTATCTGTGGAACAAAAGG + Intergenic
970582847 4:17489257-17489279 GATGTGATCTCTAGAACAAAAGG + Intronic
970660218 4:18277088-18277110 GAGATCACCTGTAGCACAAAAGG + Intergenic
971105183 4:23516850-23516872 AAGCTGCACTGTAGAACAAATGG - Intergenic
974062112 4:57044595-57044617 AAGATGGTCTTTTCAACAAATGG - Intronic
974686018 4:65230841-65230863 AAAATGACTTGCAGAACAAAAGG - Intergenic
975168286 4:71202777-71202799 ATGATGATCTGTAGAAAATGAGG + Intronic
975371234 4:73590781-73590803 AAGATTAACTGTAGAACATTTGG - Intronic
975615278 4:76239964-76239986 AAGATGATCTTTTTGACAAATGG - Intronic
976285890 4:83370759-83370781 AAGGTGCTCTGGAGCACAAATGG - Intergenic
977526683 4:98154613-98154635 AAGATGATGTGAAGAACCATAGG - Intergenic
978116792 4:105028512-105028534 AATCTGAACTGTAGACCAAATGG + Intergenic
978163127 4:105573467-105573489 AAGACAATCTTTACAACAAATGG - Intronic
980019767 4:127694750-127694772 AAGATGGTCTTTTCAACAAATGG - Intronic
981254038 4:142639918-142639940 AAGATAATCTTTTCAACAAATGG + Intronic
981530319 4:145746453-145746475 AAGATGGTCTCTACAATAAATGG - Intronic
982616367 4:157641716-157641738 ATGATGATCTGTAGAAAATATGG - Intergenic
982837280 4:160135672-160135694 AAGATAGTCTCTTGAACAAATGG + Intergenic
983136700 4:164092849-164092871 AAGATTATGTCTAGAACACAGGG + Intronic
983808241 4:172021838-172021860 AAGATAATCTGTTCAATAAATGG + Intronic
985130165 4:186730803-186730825 ATGAAGCTCTGTAGAACCAATGG + Intergenic
985336511 4:188902439-188902461 AAGATAATCTTAAGATCAAATGG - Intergenic
986873229 5:12075469-12075491 AAAATGACCTGAAGCACAAAAGG + Intergenic
986900770 5:12430605-12430627 ATAATTATCTGTAGAATAAATGG + Intergenic
988516412 5:31908452-31908474 AAGATGGTCTGTAGGAGAGAGGG + Intronic
989363109 5:40625653-40625675 CAGATGATCAGTAGAAGACAGGG - Intergenic
990204082 5:53410185-53410207 AGGATGATCTTTTCAACAAATGG - Intergenic
990895565 5:60696641-60696663 AAGAGAATCTTTACAACAAATGG + Intronic
991119130 5:62990753-62990775 AAGATAATCTTTTCAACAAATGG - Intergenic
991551881 5:67845909-67845931 AAGGTGATGTGTAGACCAAGTGG - Intergenic
992459565 5:76947765-76947787 AGGATAATCTGTTCAACAAATGG + Intergenic
992880458 5:81104178-81104200 ATGATGATCTGTAGAAAATATGG + Intronic
993186080 5:84621626-84621648 AAGATAATCTTTTCAACAAATGG + Intergenic
993304015 5:86252584-86252606 AAGAATATCAGTAAAACAAATGG + Intergenic
993800228 5:92324294-92324316 CTGATGATCTGGAGAACACAAGG - Intergenic
993975386 5:94473200-94473222 AAAAGGACCTGTAGATCAAATGG - Intronic
994430964 5:99660822-99660844 AAGATAGCCTGTACAACAAAGGG + Intergenic
994608396 5:102001730-102001752 AGGATGATCTCTTCAACAAATGG - Intergenic
995364635 5:111344162-111344184 AACCTGATTTGAAGAACAAAGGG + Intronic
995616018 5:113965181-113965203 GAGATGAACTGAAGATCAAATGG - Intergenic
996144803 5:119961058-119961080 AAGATTATCAGTATATCAAAGGG + Intergenic
996151145 5:120036350-120036372 AAGATGATTCGAAGAAGAAATGG + Intergenic
996208254 5:120770588-120770610 AAAATGTTCTGCAAAACAAAAGG + Intergenic
996245470 5:121258649-121258671 AAGAGCTTCTGTAGAGCAAAAGG - Intergenic
996688193 5:126308329-126308351 AAGATGGTCTCTGTAACAAATGG + Intergenic
997180304 5:131821509-131821531 AATCTGCACTGTAGAACAAATGG - Intronic
997338010 5:133121539-133121561 AAAATGATTTATAAAACAAAAGG + Intergenic
998924625 5:147108361-147108383 GATATGATCTATAGAAAAAATGG + Intergenic
999481582 5:151953377-151953399 AAGATGGCCTGAAAAACAAAAGG - Intergenic
999884406 5:155905095-155905117 GGGATGATCTGCAGAAGAAATGG + Intronic
1000692098 5:164336921-164336943 AAGATAAAATGTACAACAAAGGG + Intergenic
1002366268 5:178714587-178714609 AAGAGGATCTGTAGGAAAATAGG - Intronic
1002398336 5:178975564-178975586 TAGATGGTCTGATGAACAAAAGG - Intergenic
1002785737 6:398639-398661 AAGATGAGCTGGAGACCAACTGG - Intronic
1003042690 6:2702510-2702532 AAGATGAGCTGTTGATTAAAGGG + Intronic
1003843966 6:10153476-10153498 AAAATAAACTGAAGAACAAAGGG + Intronic
1003856930 6:10285998-10286020 AAGAAGATGGGTAGAACAAGAGG + Intergenic
1004747907 6:18530422-18530444 AAGAGGAGCTGTTGATCAAAGGG + Intergenic
1005629214 6:27691974-27691996 AGGACTATCTGTAAAACAAAAGG - Intergenic
1007311611 6:40950874-40950896 AAGGTGATATGTAAAAAAAAGGG - Intergenic
1007976213 6:46104061-46104083 AAGATGATTTCTGGAAGAAAAGG - Intergenic
1009194953 6:60672976-60672998 AAAATGATCTTTTCAACAAATGG - Intergenic
1009553485 6:65130754-65130776 AAGCTTACCTGTGGAACAAACGG + Intronic
1009654278 6:66519962-66519984 AATATGATCAGTCCAACAAACGG + Intergenic
1010150865 6:72730556-72730578 AAGATGAGCTATACAATAAATGG - Intronic
1010158174 6:72819973-72819995 AAGGGGATCTGTAAAGCAAAAGG - Intronic
1011094641 6:83646464-83646486 AAGATAATCTTTTGAACAAATGG - Intronic
1011716615 6:90112177-90112199 AAGATGGCCTGGAGAAGAAAAGG - Intronic
1011901663 6:92305545-92305567 AATATGTTCTGTAGACCAAATGG + Intergenic
1012384860 6:98668502-98668524 ATTTTGATCTGTAGAATAAATGG + Intergenic
1012578640 6:100835249-100835271 AAAAGCATCTGTACAACAAAGGG - Intronic
1013577415 6:111498221-111498243 GAGATGAAATGTAGAGCAAAGGG - Intergenic
1014226877 6:118859162-118859184 AAGATAATCTGTTCAACAAATGG + Intronic
1014280399 6:119436915-119436937 AAGAGGATCAGCAAAACAAATGG - Intergenic
1014290262 6:119550311-119550333 AAACTGATCATTAGAACAAATGG - Intergenic
1014759007 6:125334457-125334479 AAGATAATCTCTTCAACAAATGG - Intergenic
1014955736 6:127613647-127613669 AAGACGATCTGTCTAAGAAAGGG - Intergenic
1015398725 6:132764367-132764389 AAGAGAATCTGTGGTACAAATGG - Intergenic
1015633423 6:135253318-135253340 AAGCTGCTCTGCAAAACAAAGGG - Intergenic
1016093067 6:140002573-140002595 AAGAAGAACTGTGGAACAATGGG + Intergenic
1017556780 6:155580194-155580216 AAGGTGATCTGCAGAAGAAATGG + Intergenic
1017699812 6:157058027-157058049 AAGATGAACTGTAGTACTTAAGG + Intronic
1018754207 6:166835048-166835070 AAGATTATCTTTTTAACAAATGG - Intronic
1019863100 7:3678829-3678851 AAGGTGATCTTTTCAACAAATGG + Intronic
1020422802 7:8028087-8028109 AATCTGCACTGTAGAACAAATGG + Intronic
1020759057 7:12245335-12245357 AAATTGATCTCTAAAACAAACGG - Intergenic
1021159520 7:17254902-17254924 AAAATTATCTGTAGAAGAACCGG - Intergenic
1021528840 7:21620360-21620382 AAGAGGAGCTGTTGATCAAAGGG - Intronic
1021590999 7:22261802-22261824 AAGATGGTCTTTCCAACAAATGG + Intronic
1021806274 7:24359141-24359163 AAGATGATCTTTTCAATAAATGG + Intergenic
1022131999 7:27413290-27413312 AAAATTATTTGTAGCACAAATGG + Intergenic
1022296342 7:29057743-29057765 AAGATAGTCTTTACAACAAATGG - Intronic
1024107452 7:46107716-46107738 AAGCTGAGCTGCAGGACAAAGGG + Intergenic
1024434419 7:49333036-49333058 AAGGTGAAGTGCAGAACAAATGG - Intergenic
1024850021 7:53702139-53702161 AAGTTCATCTTTAAAACAAAGGG + Intergenic
1025026345 7:55519420-55519442 AAGCTGATCTATAAAACAATTGG + Intronic
1025039413 7:55627389-55627411 AAGGTTATGTGTAAAACAAAAGG - Intergenic
1026021571 7:66711487-66711509 AGGATAATCTTTATAACAAATGG - Intronic
1026444005 7:70468378-70468400 AACATGATCTTTAGAAGGAAAGG + Intronic
1026519081 7:71100166-71100188 AAGATAATCTTTTCAACAAATGG + Intergenic
1027964007 7:84982038-84982060 AATATGATATGTAGAACAAATGG - Intergenic
1028036978 7:85996688-85996710 AATCTGCACTGTAGAACAAAGGG - Intergenic
1028092781 7:86724171-86724193 AAGATGATGTGTAGATAAATAGG + Intronic
1028222318 7:88212289-88212311 AATATTATCTGTGGATCAAATGG - Intronic
1028303429 7:89230678-89230700 AAGATATTCTGTTGAACAAATGG + Intronic
1029085255 7:98006422-98006444 AGAATGATCTGGAGAACAATGGG - Intergenic
1030224629 7:107136084-107136106 AAGATGGTCTTTTCAACAAATGG + Intronic
1031098756 7:117451947-117451969 AATTTGCACTGTAGAACAAATGG + Intergenic
1031225216 7:119028218-119028240 AAGATAATCTTTTCAACAAATGG + Intergenic
1031337866 7:120558924-120558946 CAGATAATTTGTAGACCAAAGGG - Intronic
1033791125 7:144793194-144793216 AAGATGATCTGGAACAAAAATGG - Intronic
1033866979 7:145701669-145701691 AAGATAATCTTTGCAACAAATGG - Intergenic
1033901612 7:146148866-146148888 AAGATTATTTGTAGAAAACATGG - Intronic
1035055607 7:156033916-156033938 AAGATGATCTTTTCAATAAATGG + Intergenic
1039390558 8:37177388-37177410 GAGATGATCTGTAGATAAAATGG - Intergenic
1039624200 8:39031302-39031324 AAGATAATCTTTTCAACAAATGG - Intronic
1039790189 8:40869550-40869572 AAGATTATTAGAAGAACAAAAGG + Intronic
1040401652 8:47056250-47056272 AAAATGATCTTTAAACCAAATGG + Intergenic
1040456344 8:47601822-47601844 AAGATGAACTTTGGAACTAACGG + Intronic
1040591969 8:48801646-48801668 ATGATAATCTTTTGAACAAACGG + Intergenic
1041709715 8:60883036-60883058 AAGATGATCTGAAAAAAAATGGG - Intergenic
1041748797 8:61237082-61237104 AGGATGATCAGTAAGACAAAGGG + Intronic
1044056473 8:87576524-87576546 AATATGATCTGCAGAGGAAATGG - Intronic
1045374946 8:101562623-101562645 AAGATCATCTTTTTAACAAATGG - Intronic
1045921378 8:107534089-107534111 ATGATGATCTAGAGAACAAATGG - Intergenic
1046162322 8:110383361-110383383 AAGATAATATCTAGAAAAAAGGG + Intergenic
1046582863 8:116114313-116114335 AATATGCTTTGTAGAATAAATGG + Intergenic
1046825074 8:118680260-118680282 AGGATCATCTGTCCAACAAATGG - Intergenic
1047550361 8:125865209-125865231 AAGATAATCTCTTGAATAAATGG - Intergenic
1047672872 8:127167707-127167729 AAGATAATCTTTTCAACAAATGG - Intergenic
1047819103 8:128499032-128499054 ATGAGGATCTGGAGACCAAAAGG + Intergenic
1047950700 8:129932263-129932285 AAGATACTCTCTAGAGCAAAGGG - Intronic
1048249816 8:132853807-132853829 AAGATAATCTTTTCAACAAATGG - Intergenic
1048798590 8:138174524-138174546 AAGAAGAGCTGTAAAACAGAGGG - Intronic
1049959080 9:721142-721164 AAGTTGATCTTTAGAGCCAATGG + Intronic
1051059312 9:13027761-13027783 GAGATGCTCTGTATAAAAAAGGG - Intergenic
1051099878 9:13508720-13508742 AAAATAATCTGGAGAACTAATGG - Intergenic
1051308201 9:15739257-15739279 AACATGTTCTGTAGAACACCCGG - Intronic
1051833416 9:21307421-21307443 TAGAAGATATGTAGATCAAAGGG + Intergenic
1052559818 9:30070888-30070910 ATGATAATCTCTTGAACAAATGG + Intergenic
1053368097 9:37538035-37538057 AAGATGATCAGCAGAACAAATGG - Intronic
1056554612 9:87678130-87678152 ACCATGATCTGTAGAACACGAGG - Intronic
1057209847 9:93194008-93194030 AAGATCATCTTTTCAACAAATGG + Intronic
1057607070 9:96506568-96506590 GAGATGATGTGGAGAGCAAAAGG - Intronic
1057636324 9:96772170-96772192 AAGATGGTCTTTCTAACAAATGG + Intronic
1059011536 9:110466924-110466946 AGGATGATTTGTAGAAGAACAGG + Intronic
1059813674 9:117886622-117886644 AAGAGGAGCTATTGAACAAAAGG + Intergenic
1059888961 9:118779650-118779672 AAGTTGATCTGGGGAAAAAAGGG + Intergenic
1060194553 9:121615184-121615206 AAGATGCTTTGTAGAAAAGAAGG + Intronic
1060450247 9:123731460-123731482 AAGATGGTCTTTTCAACAAATGG + Intronic
1061292981 9:129662874-129662896 TTGCTGATCTGTAAAACAAAAGG + Intergenic
1203730996 Un_GL000216v2:89565-89587 AAGATAATCACTAGTACAAACGG - Intergenic
1203752540 Un_GL000218v1:93444-93466 AAGAAGATTTGTAGACAAAAGGG - Intergenic
1203488568 Un_GL000224v1:82149-82171 AAAAAGATCTGGAGCACAAAAGG + Intergenic
1203501189 Un_KI270741v1:24045-24067 AAAAAGATCTGGAGCACAAAAGG + Intergenic
1186224898 X:7388167-7388189 AACATGATCCCAAGAACAAAGGG - Intergenic
1186668609 X:11745746-11745768 AAGATGATCTCTTTAATAAATGG - Intergenic
1188094058 X:26001480-26001502 AAAATAATCTGATGAACAAATGG + Intergenic
1188379521 X:29473834-29473856 AAAAGGATCTGTAGATCAAAGGG - Intronic
1188674296 X:32919634-32919656 TAGATAATCTACAGAACAAATGG - Intronic
1188897129 X:35682898-35682920 ATAATGATCAGTAGAAAAAATGG - Intergenic
1188937029 X:36189093-36189115 ATAATGATCGGTAGAACAAATGG + Intergenic
1188971478 X:36621879-36621901 AAGATAATCTTTTCAACAAATGG - Intergenic
1190186745 X:48241608-48241630 AGGATTATCTGTTTAACAAATGG + Intronic
1190549696 X:51566572-51566594 AAGAAGATTTGAATAACAAATGG + Intergenic
1190668041 X:52713319-52713341 AAGATCATCTGCTTAACAAATGG - Intergenic
1190671376 X:52745085-52745107 AAGATCATCTGCTTAACAAATGG + Intergenic
1190922222 X:54864630-54864652 AAGATGATCTTTGAAACCAATGG + Intergenic
1192126028 X:68501669-68501691 AAGAGGCTGTGTAGCACAAATGG - Intronic
1193328004 X:80205227-80205249 AAAATGTTCTGTAGAGCGAATGG - Intergenic
1193409598 X:81146429-81146451 AAGATGTTCTTTAAAACCAAGGG + Intronic
1193451075 X:81667989-81668011 AATAATATTTGTAGAACAAATGG - Intergenic
1193504536 X:82325946-82325968 AACCTGAACTATAGAACAAATGG - Intergenic
1193686401 X:84581601-84581623 AGGATGATCTCTTCAACAAATGG - Intergenic
1193863410 X:86699185-86699207 AAACTGAACTCTAGAACAAACGG + Intronic
1194165937 X:90515978-90516000 AATCTGCACTGTAGAACAAATGG + Intergenic
1194222454 X:91211829-91211851 ATGATTATCTGAAGAAAAAAAGG + Intergenic
1194234352 X:91363547-91363569 AAATTGATCTGTAGATTAAATGG - Intergenic
1194902013 X:99523535-99523557 AAGCTGCACTCTAGAACAAATGG + Intergenic
1194939479 X:99992632-99992654 AATATGCTATGCAGAACAAAGGG + Intergenic
1195279849 X:103321115-103321137 AAGATGATCTGTTCAATAAATGG - Intergenic
1195383543 X:104292579-104292601 AAGGTGATGTGAAGAAGAAAGGG - Intergenic
1195837901 X:109139665-109139687 AAAATGATCTTTTCAACAAATGG + Intergenic
1196025171 X:111034333-111034355 AAGATGATCCTGAGAGCAAATGG + Intronic
1196221370 X:113114589-113114611 AAGATGCTCTTTTGAATAAATGG + Intergenic
1196939835 X:120764405-120764427 AAGATGATTTGTAATACAGAAGG - Intergenic
1197078044 X:122376796-122376818 AATCTGCACTGTAGAACAAATGG - Intergenic
1197226130 X:123958777-123958799 AAGATGGTCTATAAAAGAAATGG + Intergenic
1197452320 X:126635118-126635140 AATCTGCACTGTAGAACAAATGG - Intergenic
1198126901 X:133653760-133653782 AAGTTCATCTTTGGAACAAATGG - Intronic
1199178748 X:144826323-144826345 AAAATAATATGTAGAACATAAGG - Intergenic
1199330618 X:146553964-146553986 AAGATAGTGTGTAGAACAAACGG + Intergenic
1199450758 X:147976697-147976719 CAGGTGATCTGTAGGACAACGGG + Intergenic
1199889527 X:152062226-152062248 TAGATGATTTTTAAAACAAATGG + Intergenic
1200519453 Y:4192874-4192896 AAGATGATCTCTTCAATAAATGG - Intergenic
1200558980 Y:4675603-4675625 ACGATTATCTGAAGAAAAAAAGG + Intergenic