ID: 1063412792

View in Genome Browser
Species Human (GRCh38)
Location 10:5849645-5849667
Sequence GATCGCTTGAACCCAGGTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063412792_1063412801 5 Left 1063412792 10:5849645-5849667 CCTCGACCTGGGTTCAAGCGATC No data
Right 1063412801 10:5849673-5849695 CGCTTCAGTCTCCTGAAGCTGGG No data
1063412792_1063412800 4 Left 1063412792 10:5849645-5849667 CCTCGACCTGGGTTCAAGCGATC No data
Right 1063412800 10:5849672-5849694 CCGCTTCAGTCTCCTGAAGCTGG No data
1063412792_1063412802 13 Left 1063412792 10:5849645-5849667 CCTCGACCTGGGTTCAAGCGATC No data
Right 1063412802 10:5849681-5849703 TCTCCTGAAGCTGGGACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063412792 Original CRISPR GATCGCTTGAACCCAGGTCG AGG (reversed) Intergenic
No off target data available for this crispr