ID: 1063412793

View in Genome Browser
Species Human (GRCh38)
Location 10:5849651-5849673
Sequence GGGGGGGATCGCTTGAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063412793_1063412800 -2 Left 1063412793 10:5849651-5849673 CCTGGGTTCAAGCGATCCCCCCC No data
Right 1063412800 10:5849672-5849694 CCGCTTCAGTCTCCTGAAGCTGG No data
1063412793_1063412805 26 Left 1063412793 10:5849651-5849673 CCTGGGTTCAAGCGATCCCCCCC No data
Right 1063412805 10:5849700-5849722 CAGGTGTGCACCACCATGCCTGG 0: 1870
1: 7031
2: 30417
3: 78542
4: 159160
1063412793_1063412802 7 Left 1063412793 10:5849651-5849673 CCTGGGTTCAAGCGATCCCCCCC No data
Right 1063412802 10:5849681-5849703 TCTCCTGAAGCTGGGACCACAGG No data
1063412793_1063412801 -1 Left 1063412793 10:5849651-5849673 CCTGGGTTCAAGCGATCCCCCCC No data
Right 1063412801 10:5849673-5849695 CGCTTCAGTCTCCTGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063412793 Original CRISPR GGGGGGGATCGCTTGAACCC AGG (reversed) Intergenic
No off target data available for this crispr