ID: 1063412801

View in Genome Browser
Species Human (GRCh38)
Location 10:5849673-5849695
Sequence CGCTTCAGTCTCCTGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063412793_1063412801 -1 Left 1063412793 10:5849651-5849673 CCTGGGTTCAAGCGATCCCCCCC No data
Right 1063412801 10:5849673-5849695 CGCTTCAGTCTCCTGAAGCTGGG No data
1063412792_1063412801 5 Left 1063412792 10:5849645-5849667 CCTCGACCTGGGTTCAAGCGATC No data
Right 1063412801 10:5849673-5849695 CGCTTCAGTCTCCTGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063412801 Original CRISPR CGCTTCAGTCTCCTGAAGCT GGG Intergenic
No off target data available for this crispr