ID: 1063417685

View in Genome Browser
Species Human (GRCh38)
Location 10:5887766-5887788
Sequence TGCCCAACCGCATCTTGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 68}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063417685_1063417689 29 Left 1063417685 10:5887766-5887788 CCTGAACAAGATGCGGTTGGGCA 0: 1
1: 0
2: 0
3: 8
4: 68
Right 1063417689 10:5887818-5887840 CTGCTCACCTGCAGAGCTGTAGG 0: 1
1: 0
2: 4
3: 36
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063417685 Original CRISPR TGCCCAACCGCATCTTGTTC AGG (reversed) Intronic
900698425 1:4027490-4027512 TGCCCAAACCCATCTTGCTGAGG - Intergenic
906937772 1:50229361-50229383 TGCTCAACGATATCTTGTTCTGG + Intergenic
909750487 1:79154151-79154173 TGCACAACTGCATCTTGTTTAGG + Intergenic
916474616 1:165157297-165157319 TTCACAAGCGCATGTTGTTCTGG - Intergenic
917854296 1:179088783-179088805 TGTCCAACCTCATCTTTTTGCGG + Intronic
918312742 1:183297134-183297156 TGCCCAACAGCCTCCTGCTCTGG + Intronic
920258764 1:204674599-204674621 TGCCCACCTGCAGCTTGTTATGG + Intronic
1063417685 10:5887766-5887788 TGCCCAACCGCATCTTGTTCAGG - Intronic
1065604279 10:27400607-27400629 TGGCCAACCTCATATTGTTATGG - Intronic
1065860890 10:29871617-29871639 TGCCCCCCCGCATCCTGCTCTGG - Intergenic
1069229535 10:65991806-65991828 TGGGCATCCTCATCTTGTTCCGG + Intronic
1070628666 10:78068923-78068945 TGCCAAACAGCTTCATGTTCTGG + Intergenic
1072325198 10:94291270-94291292 TGCACCACTGCATCTGGTTCTGG + Intronic
1081591238 11:44424717-44424739 TGCCCAAACACACCTTGCTCCGG - Intergenic
1083781944 11:64923349-64923371 TGCCCTCCCTCAGCTTGTTCAGG + Intronic
1088843993 11:113649649-113649671 TGCCCACCCGGAACTTGTGCTGG + Intergenic
1089868323 11:121651166-121651188 GGCCCAGCCACATCTAGTTCAGG - Intergenic
1092242989 12:6846950-6846972 TGCCCGACCCCATCTCATTCAGG + Exonic
1097310755 12:58116463-58116485 TCCCCAACCTCATGTTCTTCAGG - Intergenic
1113372289 13:109734335-109734357 TGCCCCAGCGCCTCCTGTTCTGG - Intergenic
1114418237 14:22558300-22558322 TGGCCCAGCCCATCTTGTTCGGG - Intronic
1114531105 14:23396977-23396999 TCCCCAACCGCATCCTCTACGGG - Exonic
1114536458 14:23425978-23426000 TCCCCAACCGCATCCTCTACGGG - Exonic
1117536273 14:56705896-56705918 TGCTCAACAGCATCTAGTCCAGG - Intronic
1122759409 14:104010910-104010932 TGTTCAACCCCATGTTGTTCAGG + Intronic
1122958790 14:105085112-105085134 TGCCCAAGCCCATCATGTTCTGG + Intergenic
1124657135 15:31517720-31517742 TGCCCACCCCCATCTTTCTCAGG - Intronic
1127772466 15:62242905-62242927 TCCCCAGCCTCTTCTTGTTCAGG + Intergenic
1128717332 15:69918232-69918254 GGCCCAACCGCTTCTTGTCCTGG + Intergenic
1129660610 15:77550889-77550911 TGCCCAACCCCACCCTGCTCTGG - Intergenic
1134227040 16:12399343-12399365 TGCCCAGCCGATTTTTGTTCAGG + Intronic
1134358533 16:13507504-13507526 TTCCCAGCCTCATCTTGTTTTGG + Intergenic
1137686244 16:50388888-50388910 TGCCCAACCCCATCTTTCTCTGG - Intergenic
1146174016 17:30653388-30653410 TCCCCACCAGCATCATGTTCTGG + Intergenic
1146347471 17:32069415-32069437 TCCCCACCAGCATCATGTTCTGG + Intergenic
1147646575 17:42037939-42037961 AGCCCACCCGCCTCTTGTTCTGG - Intronic
1148551788 17:48554899-48554921 TTCCCCACCCCCTCTTGTTCTGG - Intronic
1150604166 17:66676636-66676658 TGGCCAACCCCACCTTGTTCAGG - Intronic
1160008311 18:75084862-75084884 TGGCAAACTGGATCTTGTTCTGG - Intergenic
1162488806 19:10979048-10979070 TGTCCAATCGCATCTTCTTATGG - Intronic
1163345726 19:16740852-16740874 TGCCCTACAGAATCTTGTGCAGG + Intronic
1163495991 19:17646915-17646937 TGCTCAACGGCATCTCCTTCAGG + Intronic
925856228 2:8132546-8132568 TGCCAAACCGCACCTGGTTTTGG + Intergenic
931708940 2:64970785-64970807 TAAACAACCCCATCTTGTTCAGG - Intergenic
932508175 2:72257048-72257070 TGCCCCATCTCATCATGTTCTGG + Intronic
933026029 2:77260813-77260835 TTCCCAACTGCATTTTGATCAGG - Intronic
937794613 2:126002343-126002365 TGCCCAAAGGCATTTTGTTGTGG + Intergenic
1171817987 20:29805454-29805476 GGCCCCACTGCATGTTGTTCTGG + Intergenic
1171900253 20:30849824-30849846 GGCCCCACTGCATGTTGTTCTGG - Intergenic
1175413227 20:58785100-58785122 GGCCCACCAGCATCTTGCTCTGG - Intergenic
1176143625 20:63555690-63555712 TGCCCAGCTTCATCTTGTCCAGG - Exonic
1180321433 22:11324938-11324960 GGCCCCACTGCATGTTGTTCTGG + Intergenic
1180333617 22:11555815-11555837 GGCCCCACGGCATGTTGTTCTGG - Intergenic
1182412500 22:30199106-30199128 TCCCCAACCTAATTTTGTTCTGG + Intergenic
1184036952 22:41922829-41922851 TGCCCCACCCCATCTTTTCCTGG - Intergenic
1185346333 22:50312473-50312495 TGCCCACCCCCACCATGTTCTGG + Intronic
960654979 3:119993211-119993233 TGGCCAACCTCATTATGTTCTGG - Intronic
971869344 4:32215873-32215895 TGCTCACCCTCCTCTTGTTCAGG - Intergenic
976901441 4:90181717-90181739 TGCCAATTCACATCTTGTTCAGG - Intronic
985421340 4:189788029-189788051 TGCCCAGCGGCCTCTTCTTCTGG + Intergenic
985442422 4:189992720-189992742 GGCCCCACTGCATGTTGTTCTGG + Intergenic
1003777906 6:9390062-9390084 TGCCCATCCCCATCAGGTTCTGG + Intergenic
1007039014 6:38704206-38704228 TGCCCAACCTCATTTTGGTTAGG - Intergenic
1007971144 6:46053482-46053504 TGCACAACCTCATATTGCTCAGG + Intronic
1009548351 6:65052187-65052209 TACCCAACCCCATTTAGTTCTGG + Intronic
1015411174 6:132895416-132895438 TGCCCAACCAGACCTTGTTTTGG + Intergenic
1017105363 6:150882867-150882889 TACCCATCCACATCTTTTTCTGG - Exonic
1024093637 7:45967724-45967746 TGCCCAAGGTCACCTTGTTCAGG - Intergenic
1029996916 7:105014921-105014943 TTCTCAACCGCGTCTTGTTCAGG + Intronic
1032740915 7:134738118-134738140 TTTCCACCCCCATCTTGTTCAGG + Intergenic
1040794152 8:51271285-51271307 TGCCCACCCGGAACTTGTTCTGG - Intergenic
1048506224 8:135024674-135024696 TGCCCAAGCTCATATAGTTCAGG + Intergenic
1051505463 9:17822712-17822734 TGCCCAACCACATCTAGCGCTGG + Intergenic
1059757155 9:117304283-117304305 AGCCCAACCCCATCTTGTGGTGG - Intronic
1060412209 9:123407227-123407249 TGACCAACCGCCTCTGGGTCTGG - Intronic
1203369650 Un_KI270442v1:290718-290740 GGCCCCACTGCATGTTGTTCTGG + Intergenic
1189989310 X:46579120-46579142 TCCCCATCCTGATCTTGTTCCGG - Intronic