ID: 1063417724

View in Genome Browser
Species Human (GRCh38)
Location 10:5888041-5888063
Sequence CTTGTGCAGGCCATCATCAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 119}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063417719_1063417724 -10 Left 1063417719 10:5888028-5888050 CCCCAGGTTCTTCCTTGTGCAGG 0: 1
1: 0
2: 1
3: 27
4: 266
Right 1063417724 10:5888041-5888063 CTTGTGCAGGCCATCATCAGAGG 0: 1
1: 0
2: 0
3: 11
4: 119
1063417717_1063417724 0 Left 1063417717 10:5888018-5888040 CCTGGATCACCCCCAGGTTCTTC 0: 1
1: 0
2: 0
3: 15
4: 219
Right 1063417724 10:5888041-5888063 CTTGTGCAGGCCATCATCAGAGG 0: 1
1: 0
2: 0
3: 11
4: 119
1063417715_1063417724 6 Left 1063417715 10:5888012-5888034 CCAGCTCCTGGATCACCCCCAGG 0: 1
1: 0
2: 2
3: 32
4: 392
Right 1063417724 10:5888041-5888063 CTTGTGCAGGCCATCATCAGAGG 0: 1
1: 0
2: 0
3: 11
4: 119
1063417714_1063417724 9 Left 1063417714 10:5888009-5888031 CCACCAGCTCCTGGATCACCCCC 0: 1
1: 0
2: 3
3: 42
4: 424
Right 1063417724 10:5888041-5888063 CTTGTGCAGGCCATCATCAGAGG 0: 1
1: 0
2: 0
3: 11
4: 119
1063417713_1063417724 16 Left 1063417713 10:5888002-5888024 CCATGTTCCACCAGCTCCTGGAT 0: 1
1: 0
2: 2
3: 25
4: 272
Right 1063417724 10:5888041-5888063 CTTGTGCAGGCCATCATCAGAGG 0: 1
1: 0
2: 0
3: 11
4: 119
1063417718_1063417724 -9 Left 1063417718 10:5888027-5888049 CCCCCAGGTTCTTCCTTGTGCAG 0: 1
1: 0
2: 2
3: 29
4: 234
Right 1063417724 10:5888041-5888063 CTTGTGCAGGCCATCATCAGAGG 0: 1
1: 0
2: 0
3: 11
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063417724 Original CRISPR CTTGTGCAGGCCATCATCAG AGG Exonic
900659677 1:3776284-3776306 CTTGTGAAGGCCAGGATGAGGGG + Intergenic
901047340 1:6405136-6405158 CATGTGCAGGAGATAATCAGCGG + Intergenic
902153896 1:14467808-14467830 CTTCTGGGGGCCATCATGAGAGG - Intergenic
903375476 1:22863171-22863193 CTTGTGCAGGGCATGTCCAGGGG - Exonic
903902955 1:26661838-26661860 CAGGTGCAGGCCATCATCCCCGG - Intergenic
904999123 1:34654389-34654411 CGTGTGCAGGCCAGTCTCAGAGG - Intergenic
905555845 1:38883595-38883617 CTAGTGCTGACCATCATCAGTGG - Intergenic
906003558 1:42448255-42448277 TTTGTGCAGGCCAGCTTGAGTGG + Intronic
912384320 1:109263733-109263755 CTGCTGCAGGCCATCACCAGGGG + Exonic
912427022 1:109602957-109602979 CTTGTGCAGGCCAGGCACAGTGG - Exonic
912653254 1:111460605-111460627 GTTGTACAAGCCAACATCAGTGG + Intronic
919430721 1:197487879-197487901 CTTGTGCAGGCCTGAATCTGCGG - Intergenic
919763429 1:201112203-201112225 CTGATGCAGGCCTTCCTCAGGGG + Exonic
922669653 1:227499536-227499558 CTTGTGCAGGAAAACATCTGAGG - Intergenic
923135117 1:231110511-231110533 CCTGTGCAGCCCATCACCACTGG - Intergenic
1062824999 10:560788-560810 CTAGTCCAGGCCATGATCGGTGG + Intronic
1063417679 10:5887753-5887775 CTTGTTCAGGTCACCTTCAGGGG - Intronic
1063417724 10:5888041-5888063 CTTGTGCAGGCCATCATCAGAGG + Exonic
1068050942 10:51947924-51947946 CTTGTGCATGCCCTCATCTGAGG - Intronic
1068071714 10:52204715-52204737 TTTGTGCATGCAATCATCACAGG - Intronic
1068532856 10:58209112-58209134 CTTGTGCAGGCCTGAATCTGGGG + Intronic
1069894255 10:71670796-71670818 CTTGTGAAGGCTCTCATAAGAGG - Intronic
1070499195 10:77054452-77054474 CTTCTGCACACCAGCATCAGTGG + Intronic
1072887526 10:99291913-99291935 CCTGTGCAGGCCTTTCTCAGTGG - Intergenic
1074164607 10:110864019-110864041 CTTGTCCAGCCCACCATCACTGG - Intergenic
1082042687 11:47699316-47699338 CTTTTCCAGGCCAACATGAGTGG - Intronic
1082095635 11:48127149-48127171 CTTGTGCAAGGCATCATGGGGGG - Intronic
1087652660 11:100886112-100886134 CTTGGGCAAGTCAACATCAGAGG + Intronic
1089145789 11:116328959-116328981 CCTATCCAGGCCAGCATCAGAGG - Intergenic
1089830634 11:121324517-121324539 CAGGTGCAGGCCATCATGTGTGG + Intergenic
1098654690 12:73013345-73013367 CTTGTGCAGGCCTGAATCTGGGG + Intergenic
1101131301 12:101693897-101693919 CTTCTGAAGGCCATGATCAAAGG - Intergenic
1102538314 12:113599036-113599058 ATTGTGCAGACCATCTTCAGAGG + Intergenic
1107168924 13:37316960-37316982 CATGTGCATGCCAGCAGCAGTGG + Intergenic
1111962332 13:94825296-94825318 CTTAATCAGTCCATCATCAGTGG + Intergenic
1112568987 13:100576839-100576861 CTTGTACTGGCCATCACCAACGG - Intronic
1112829960 13:103437253-103437275 CTTGTCCAGGCCATCATTTAGGG - Intergenic
1114375049 14:22136464-22136486 TCTGTGCAGGACATCATCACTGG - Intergenic
1114997554 14:28375481-28375503 CTGGTGCAGGCAAACACCAGAGG + Intergenic
1119666123 14:76486322-76486344 CATGTGCAGGGCATCCCCAGAGG + Intronic
1124254725 15:28131322-28131344 CTGGAGCAGACCCTCATCAGTGG - Intronic
1125078604 15:35650568-35650590 CCTTTGTAGGCCATGATCAGAGG + Intergenic
1126387736 15:48111142-48111164 ATTGGGCAGGCCATCAGCTGGGG - Intergenic
1128112746 15:65086891-65086913 CTTGAGCAGGCCAGCAGCAGTGG - Intergenic
1128906683 15:71473798-71473820 GATGTGCAGGCCACCATCAGTGG + Intronic
1131735219 15:95324971-95324993 CTTCTGCGGGCGATCCTCAGTGG + Intergenic
1133444464 16:5848270-5848292 CCTGTGCAGCCCACCACCAGTGG + Intergenic
1139971766 16:70780809-70780831 CTTTGGCAGGGCATCGTCAGGGG + Exonic
1142068803 16:88077967-88077989 CTTGTGGTGGCCATCTTCAGAGG - Intronic
1142814527 17:2414871-2414893 CGTGTGATGCCCATCATCAGTGG + Intronic
1144269061 17:13600654-13600676 CTGCCGCAGGCCATCATCATCGG - Exonic
1144339812 17:14301927-14301949 CTGCCGCAGGCCATCATCATCGG + Exonic
1144834272 17:18148741-18148763 CCTGTGCATGCCATCACCAGGGG + Exonic
1146469007 17:33109649-33109671 ACTGCGCAGGTCATCATCAGGGG - Intronic
1146891552 17:36509567-36509589 CTTGTGCAGAACTACATCAGGGG - Intronic
1149544120 17:57490534-57490556 CTTGTGCATGCCTTTATAAGAGG + Intronic
1150837506 17:68577656-68577678 AATTTTCAGGCCATCATCAGAGG - Intronic
1152331447 17:79675508-79675530 CTTGAGCAGGCCAGCCTCGGGGG + Intergenic
1152504506 17:80739047-80739069 ATGGTGCTGGCCATCATCTGTGG - Intronic
1153700502 18:7688553-7688575 CTCCTGAAGGCCATCATCTGGGG - Intronic
1156637198 18:39046089-39046111 TTTGTACAGGCAATCATCAAAGG - Intergenic
1159866728 18:73714381-73714403 CGTGTGCAACCCAGCATCAGTGG - Intergenic
1162604144 19:11694299-11694321 CTTGTTCAGGCCATCATGGAAGG - Intergenic
1163224668 19:15949699-15949721 CTTGTGCCGGCCTTCGGCAGAGG - Exonic
1164193956 19:22936876-22936898 CATGTGCAGGACCTCACCAGTGG - Intergenic
1164401388 19:27904554-27904576 CCTGTGCTGGCCTTCACCAGGGG + Intergenic
1164853064 19:31500617-31500639 CTTGTGCTTGCCAACAGCAGAGG + Intergenic
926368499 2:12155980-12156002 CTTGTGCAGCCCATAGTCTGGGG - Intergenic
929592119 2:43154188-43154210 CTGATGCAGGCTATGATCAGGGG - Intergenic
929997404 2:46837352-46837374 CTTGTCCAGGCCTTCTTCACAGG + Intronic
930051169 2:47217335-47217357 CTTGTCCAGCCCATTGTCAGGGG + Intergenic
930552917 2:52858365-52858387 TTTATTCAGGCCATCATCACTGG - Intergenic
937244490 2:120483759-120483781 CGTGGGGAGGCCATCATCATGGG + Intergenic
940881710 2:158953380-158953402 CTGCTTCAGGACATCATCAGGGG + Intergenic
942256807 2:174110585-174110607 CAGGTGCAGGCCATCACAAGAGG + Intronic
945386138 2:209203260-209203282 TTTGTGCAGGCAATCATCACAGG + Intergenic
946038362 2:216762803-216762825 CTGGAGCAGGCCATCAACAAGGG - Intergenic
948730628 2:239961624-239961646 CCTCTGCAGGCCCTCTTCAGAGG - Intronic
1176049672 20:63111339-63111361 CATGACCAGGCCATCCTCAGTGG + Intergenic
1176084034 20:63287839-63287861 GTTGTCCCAGCCATCATCAGTGG - Exonic
1178719911 21:34999057-34999079 GTTGTGCTGGCCATCAGCACTGG + Intronic
1179246231 21:39636540-39636562 CCTGTGAATGCCATCATCTGGGG - Intronic
1181812297 22:25410918-25410940 CCTGGGCAGGCCCTCATGAGTGG + Intergenic
1185227114 22:49659501-49659523 CTGGTGAAGGCCGGCATCAGTGG + Intergenic
953284679 3:41595187-41595209 GATGTGCAGGCCAGCTTCAGAGG + Intronic
954941215 3:54374983-54375005 CATGTTCAGGCAATCATGAGTGG - Intronic
956840065 3:73131124-73131146 CTTGTGCCTTCCATCATCTGAGG - Intergenic
961110536 3:124279587-124279609 CTTGAGGAGGACCTCATCAGTGG + Intronic
973666826 4:53168354-53168376 CTTCTGCAGGCCTAAATCAGGGG - Intronic
973846599 4:54919253-54919275 ATTTTGCAGGCAATCAACAGAGG + Intergenic
974006091 4:56558736-56558758 TTTGGCCAGGCCATTATCAGTGG - Intronic
978569791 4:110124312-110124334 TTTGTCCAGTCCATCATTAGTGG - Intronic
980988686 4:139719378-139719400 CTTGTGGACTCCATCATCAAAGG - Exonic
983059428 4:163140463-163140485 CTTGTTCTGGCAATTATCAGTGG - Intronic
984315885 4:178130632-178130654 CTTGTGCAGGCACACATGAGTGG + Intergenic
985119867 4:186629674-186629696 ATGGTGCAGGCCATGAACAGAGG + Intronic
994707646 5:103224711-103224733 CTTATGCACGCCTTCAGCAGGGG - Intergenic
996078827 5:119231548-119231570 CTCCTGGAGGTCATCATCAGGGG + Intronic
998605930 5:143634550-143634572 CATGTGCAGGCCCTCACTAGAGG + Intergenic
999276953 5:150337891-150337913 CCAGTGCAGCCCATCAACAGAGG + Intronic
1000809835 5:165847285-165847307 TTTCTGAAGGCGATCATCAGTGG - Intergenic
1002115347 5:176958041-176958063 CTTATGCTGGCAACCATCAGAGG + Intronic
1002475735 5:179464691-179464713 CGTTGGCAGGCCATCAACAGCGG - Intergenic
1003121407 6:3321811-3321833 CTGGTGCAGGCCAGCAGCAGAGG + Intronic
1006937418 6:37728117-37728139 CTTGTGAAGGCCCCCATGAGAGG - Intergenic
1008468830 6:51860271-51860293 CTTGTACTGACCATCACCAGGGG + Intronic
1010454927 6:76043872-76043894 TTGCTGCTGGCCATCATCAGGGG - Intronic
1011998016 6:93617952-93617974 CCTGTGCTGGGCCTCATCAGTGG - Intergenic
1012673574 6:102088179-102088201 TTTGTACATGCCATAATCAGGGG + Intergenic
1013447265 6:110242764-110242786 CTGGTGCAGGCCATGAGAAGAGG - Intronic
1014421048 6:121245744-121245766 CTTGTGCAGGCCTGAATCTGGGG - Intronic
1016402808 6:143699049-143699071 CTTGTGCATGCCCTCATCTGAGG + Intronic
1027374909 7:77538572-77538594 CTTGTGCAGGCAGTCTTGAGAGG + Intronic
1032079336 7:128850887-128850909 CTGGTGCAGGCCTTTCTCAGTGG - Exonic
1032513430 7:132490044-132490066 CATGTGCAGGCAATCAGCTGGGG + Intronic
1034860473 7:154590897-154590919 CTTGTCGAGGCCATCATTATGGG - Intronic
1035348225 7:158222331-158222353 TTTTTCCAGTCCATCATCAGTGG - Intronic
1036930213 8:12949542-12949564 CTAGTTGAGGCCATCATAAGCGG - Intronic
1038049244 8:23793461-23793483 CATGTGCTGGCCATGTTCAGTGG - Intergenic
1039198470 8:35059862-35059884 CTTGTGCAGGCCTGAATCTGGGG + Intergenic
1041700709 8:60786200-60786222 CTTTTGCTAGCCAGCATCAGTGG + Intronic
1042805036 8:72761824-72761846 CTTGTACAGGCTGTCAGCAGTGG - Intronic
1051226799 9:14907975-14907997 CCTGTGCATGCCATCCCCAGTGG + Intronic
1051964980 9:22816634-22816656 CTTGTGGAGACCCTCTTCAGTGG - Intergenic
1058343045 9:103921243-103921265 CTTGTGCAGGCCTGAATCTGGGG - Intergenic
1060036174 9:120257634-120257656 CTTTTTCTGGACATCATCAGAGG + Intergenic
1189750300 X:44213815-44213837 CTAGTTCAGGCCATGATGAGGGG - Intronic
1194823274 X:98531316-98531338 CTTGTGGGGGTGATCATCAGTGG - Intergenic
1195610620 X:106863089-106863111 CTCGTGCATGCCAGCATCCGTGG + Intronic
1196829440 X:119764710-119764732 CTTGTGAAGAACATCAGCAGAGG - Intergenic
1199410456 X:147516491-147516513 CTTGTGCTTGCCAGCATCTGAGG - Intergenic