ID: 1063417966

View in Genome Browser
Species Human (GRCh38)
Location 10:5889389-5889411
Sequence GCGGGCGGGACACCGGCGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 287}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063417951_1063417966 15 Left 1063417951 10:5889351-5889373 CCATCGCCGCGGGTCGGGCCGGG 0: 1
1: 0
2: 1
3: 8
4: 131
Right 1063417966 10:5889389-5889411 GCGGGCGGGACACCGGCGGCCGG 0: 1
1: 0
2: 1
3: 22
4: 287
1063417946_1063417966 25 Left 1063417946 10:5889341-5889363 CCGGGCTGGGCCATCGCCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1063417966 10:5889389-5889411 GCGGGCGGGACACCGGCGGCCGG 0: 1
1: 0
2: 1
3: 22
4: 287
1063417944_1063417966 26 Left 1063417944 10:5889340-5889362 CCCGGGCTGGGCCATCGCCGCGG 0: 1
1: 0
2: 0
3: 18
4: 189
Right 1063417966 10:5889389-5889411 GCGGGCGGGACACCGGCGGCCGG 0: 1
1: 0
2: 1
3: 22
4: 287
1063417953_1063417966 9 Left 1063417953 10:5889357-5889379 CCGCGGGTCGGGCCGGGCTGCGC 0: 1
1: 0
2: 0
3: 20
4: 216
Right 1063417966 10:5889389-5889411 GCGGGCGGGACACCGGCGGCCGG 0: 1
1: 0
2: 1
3: 22
4: 287
1063417959_1063417966 -3 Left 1063417959 10:5889369-5889391 CCGGGCTGCGCGGGGAGGCGGCG 0: 1
1: 0
2: 1
3: 56
4: 420
Right 1063417966 10:5889389-5889411 GCGGGCGGGACACCGGCGGCCGG 0: 1
1: 0
2: 1
3: 22
4: 287
1063417943_1063417966 27 Left 1063417943 10:5889339-5889361 CCCCGGGCTGGGCCATCGCCGCG 0: 1
1: 0
2: 1
3: 25
4: 102
Right 1063417966 10:5889389-5889411 GCGGGCGGGACACCGGCGGCCGG 0: 1
1: 0
2: 1
3: 22
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063417966 Original CRISPR GCGGGCGGGACACCGGCGGC CGG Exonic