ID: 1063421699

View in Genome Browser
Species Human (GRCh38)
Location 10:5917321-5917343
Sequence CCCATACAGCAGTGGAGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 164}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063421699_1063421706 15 Left 1063421699 10:5917321-5917343 CCCTGGCTCCACTGCTGTATGGG 0: 1
1: 0
2: 0
3: 29
4: 164
Right 1063421706 10:5917359-5917381 CGCAGGGTGCTGCCTTTGCCAGG 0: 1
1: 0
2: 0
3: 22
4: 242
1063421699_1063421707 16 Left 1063421699 10:5917321-5917343 CCCTGGCTCCACTGCTGTATGGG 0: 1
1: 0
2: 0
3: 29
4: 164
Right 1063421707 10:5917360-5917382 GCAGGGTGCTGCCTTTGCCAGGG 0: 1
1: 0
2: 1
3: 38
4: 363
1063421699_1063421703 -2 Left 1063421699 10:5917321-5917343 CCCTGGCTCCACTGCTGTATGGG 0: 1
1: 0
2: 0
3: 29
4: 164
Right 1063421703 10:5917342-5917364 GGAGTTGACAGTGTGACCGCAGG 0: 1
1: 0
2: 1
3: 6
4: 73
1063421699_1063421710 30 Left 1063421699 10:5917321-5917343 CCCTGGCTCCACTGCTGTATGGG 0: 1
1: 0
2: 0
3: 29
4: 164
Right 1063421710 10:5917374-5917396 TTGCCAGGGTCTCAAACTCTGGG 0: 1
1: 1
2: 10
3: 57
4: 305
1063421699_1063421709 29 Left 1063421699 10:5917321-5917343 CCCTGGCTCCACTGCTGTATGGG 0: 1
1: 0
2: 0
3: 29
4: 164
Right 1063421709 10:5917373-5917395 TTTGCCAGGGTCTCAAACTCTGG 0: 1
1: 0
2: 0
3: 18
4: 173
1063421699_1063421704 -1 Left 1063421699 10:5917321-5917343 CCCTGGCTCCACTGCTGTATGGG 0: 1
1: 0
2: 0
3: 29
4: 164
Right 1063421704 10:5917343-5917365 GAGTTGACAGTGTGACCGCAGGG 0: 1
1: 0
2: 1
3: 6
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063421699 Original CRISPR CCCATACAGCAGTGGAGCCA GGG (reversed) Intronic
900147614 1:1165294-1165316 CCCACCCAGCCCTGGAGCCAGGG + Intergenic
903500477 1:23797651-23797673 TCCATCGATCAGTGGAGCCAGGG + Intronic
904111161 1:28127570-28127592 GCCCTACAGCTGTTGAGCCATGG - Intergenic
904631782 1:31848161-31848183 CCGAGACAGAAGTGGGGCCAGGG + Intergenic
908631208 1:66110057-66110079 CCAACACTGCAGTGGAGTCAGGG + Intronic
910631782 1:89362989-89363011 TCCATTTAGCAGTGCAGCCATGG + Intergenic
912417576 1:109520487-109520509 CACATGCAGCAGTGGGGCCAAGG + Intergenic
913186036 1:116372236-116372258 CCCAAAGTGCAGTGGAACCAGGG + Intergenic
913451941 1:118998600-118998622 CCCAGACAGAGGTGCAGCCAAGG - Intergenic
915824130 1:159057178-159057200 CCCATGAAGCAGGGGAGCCTAGG + Intergenic
919366598 1:196669454-196669476 TGCATACAGCAGTGGGGCCCAGG - Intronic
920884383 1:209912295-209912317 CCAAAAGAGCAGTGGTGCCAGGG + Intergenic
921889592 1:220340336-220340358 TCAATACAGCAGTTGAGTCATGG + Intergenic
923110063 1:230883231-230883253 CCCCAAAAGGAGTGGAGCCAGGG - Intergenic
924667822 1:246091321-246091343 CCCATCCAGCGGTGGAGGCTGGG - Intronic
1063046019 10:2393111-2393133 CCCACACAGAAGGGGAGCCAAGG - Intergenic
1063421699 10:5917321-5917343 CCCATACAGCAGTGGAGCCAGGG - Intronic
1065777244 10:29132321-29132343 TCCTTTCAGCAGTGGGGCCAAGG + Intergenic
1067568452 10:47354488-47354510 CACACACAGAACTGGAGCCAGGG - Intronic
1070782634 10:79146550-79146572 GCCACACAGGAGGGGAGCCAAGG - Intronic
1071743499 10:88388939-88388961 ACCATGCATCAGTGGAGCCATGG + Intronic
1071841367 10:89475260-89475282 CCTTTACAGCAGTGTAGCAAAGG + Intronic
1073546015 10:104349608-104349630 CCCTAACACCAGTGGAGACAGGG + Intergenic
1075188277 10:120282785-120282807 CCCCTACAGCTGTGGAGTCTGGG - Intergenic
1075624371 10:123951038-123951060 CCCATGCAGCAGAGGAGTCTTGG - Intergenic
1077300872 11:1846362-1846384 CCCAGACAGCCCTGGAGCCCAGG + Intergenic
1078089849 11:8258278-8258300 CCCATATAGCAGGGAGGCCAAGG - Intronic
1080028710 11:27638335-27638357 CCCCTCCAGCAATGGATCCAGGG - Intergenic
1081551313 11:44115055-44115077 AGCATAAAGCAGAGGAGCCAGGG - Intronic
1082948025 11:58780727-58780749 TGCACACAGCAGGGGAGCCATGG + Intergenic
1083388826 11:62333299-62333321 GCCATCGAGCAGTGGAGCCATGG - Intergenic
1085252166 11:75151072-75151094 TCTATACAACCGTGGAGCCAGGG + Exonic
1087637590 11:100719938-100719960 CACATTCAGCAGGGGAGGCAAGG - Intronic
1089443046 11:118531929-118531951 CCCAAACAGAAGTGCAGACAGGG - Intronic
1090179635 11:124685186-124685208 TGCATACAGCAGGGGAGCCCTGG - Intronic
1092710372 12:11330319-11330341 CCCATCTGCCAGTGGAGCCAGGG - Intergenic
1094310331 12:29073887-29073909 CCAATTCAGCAGTACAGCCAAGG - Intergenic
1095382574 12:41613381-41613403 CCCAACCAACAGTGAAGCCAAGG - Intergenic
1095417626 12:41993659-41993681 GCCACACAGGAGGGGAGCCAGGG + Intergenic
1096538568 12:52290472-52290494 CCCACTCAGGAGTGGAGCAAGGG + Intronic
1096540211 12:52302892-52302914 CCCACTCAGGAGTGGAGCAAGGG - Intronic
1096814866 12:54195742-54195764 CCTGTAGAGCAGGGGAGCCAGGG - Intergenic
1103345285 12:120245169-120245191 CCCATGGAGCAGAGGAGGCAGGG + Intronic
1105258562 13:18761571-18761593 TGCACACAGCAGTGGAGCCATGG + Intergenic
1105261230 13:18780872-18780894 TGCACACAGCAGTGGAGCCATGG + Intergenic
1105263555 13:18797467-18797489 TGCACACAGCAGTGGAGCCATGG + Intergenic
1106180053 13:27362547-27362569 CCCAAACAGCAGCGGCGACAGGG - Intergenic
1113884105 13:113648486-113648508 CCCAGACAGCAGTGAGGCCTGGG - Intergenic
1118741570 14:68743199-68743221 CTCCTACAGCCCTGGAGCCAAGG + Intergenic
1121793945 14:96720362-96720384 CCCCTTGAGCTGTGGAGCCAAGG + Intergenic
1122688031 14:103519127-103519149 CCCAATGACCAGTGGAGCCAGGG + Intergenic
1122802311 14:104237841-104237863 CTCATGCAGGAGTGGAGCCCAGG - Intergenic
1123007929 14:105333364-105333386 CTAACACAGCAGTGGCGCCATGG - Intronic
1123106774 14:105845440-105845462 CCCCTCCAGCAGTGGCGCCAAGG - Intergenic
1202834881 14_GL000009v2_random:70573-70595 TGCACACAGCAGTGGAGCCATGG - Intergenic
1124477305 15:30045763-30045785 ATCATACAGCAGTGGACACAGGG - Intergenic
1127684689 15:61331515-61331537 TCCATACAGGAAAGGAGCCAAGG - Intergenic
1128158856 15:65409955-65409977 CCCATTGAGCTGTGGAGCCTGGG - Intronic
1130196228 15:81782590-81782612 CCCATACACCCTTGCAGCCAGGG + Intergenic
1130410054 15:83639714-83639736 CATGTACAGCTGTGGAGCCAGGG + Intergenic
1132206387 15:99988808-99988830 CCCAAACAGCAGAGGAGGGAAGG + Intronic
1133270970 16:4610646-4610668 CCCACTCAGCAGTCCAGCCAGGG - Intronic
1136381440 16:29897893-29897915 CCCATGAAGCAGTTCAGCCAGGG + Exonic
1137777567 16:51069239-51069261 CCCTTTGAGCTGTGGAGCCAAGG - Intergenic
1137778718 16:51078276-51078298 TGCATAAAGCAGTGGAGCCCTGG + Intergenic
1139493921 16:67302324-67302346 CCCATACTGCAGTCCAGGCAGGG - Intronic
1140102839 16:71933275-71933297 ACCATAAAGCAGTAGAGCAAAGG + Intronic
1141949319 16:87330541-87330563 CCCCTCCAGCTTTGGAGCCAAGG - Exonic
1144034895 17:11356297-11356319 CACATAGGCCAGTGGAGCCAGGG - Intronic
1146430845 17:32792919-32792941 GTCATACAGCACTGGAGCCCTGG + Intronic
1147166080 17:38594137-38594159 CACAAACAGCAGAGGGGCCAAGG - Intronic
1149803975 17:59597020-59597042 CCCATACAGCACTTTATCCAGGG - Intronic
1149842521 17:59978458-59978480 CCCATACAGCACTTTATCCAGGG + Intergenic
1150151051 17:62808891-62808913 GCCCTACAGCTTTGGAGCCAGGG + Intergenic
1150578972 17:66454983-66455005 CCCAGGCAGCAGTGGAGGGAAGG + Intronic
1151146871 17:72049388-72049410 CCAACACAGCAGAGAAGCCACGG + Intergenic
1152326916 17:79646972-79646994 CCAGCCCAGCAGTGGAGCCAGGG + Intergenic
1152425560 17:80216822-80216844 CACACACAGCAGTGCAGCCAGGG + Intronic
1154424795 18:14263936-14263958 TGCACACAGCAGTGGAGCCATGG - Intergenic
1154427478 18:14283271-14283293 TGTACACAGCAGTGGAGCCATGG - Intergenic
1154430204 18:14302807-14302829 TGCACACAGCAGTGGAGCCATGG - Intergenic
1154432485 18:14319159-14319181 TGCACACAGCAGTGGAGCCATGG - Intergenic
1158137678 18:54224447-54224469 GCCATAGAGCAGGGGGGCCAGGG - Exonic
1161071076 19:2261448-2261470 GCCAGGCAGCAGTGGAGTCAGGG - Intronic
1163709991 19:18840661-18840683 CCCGAACAGCACTGGTGCCAGGG - Intronic
1164733351 19:30522133-30522155 GCCACAGAGCAGAGGAGCCAAGG - Intronic
1165117464 19:33537521-33537543 GCAATACAGAAATGGAGCCAGGG - Intergenic
1166252771 19:41582747-41582769 CGCACACAGCAGGGGAGCCCTGG + Intronic
1202637822 1_KI270706v1_random:57119-57141 TGCACACAGCAGTGGAGCCATGG + Intergenic
927922544 2:26984507-26984529 CTCAGACAGCAGTGGCACCAGGG + Intronic
928403163 2:30993841-30993863 CCCCTCCAGCAGAGGAGGCAAGG + Intronic
929075802 2:38077666-38077688 GCCATCAAGAAGTGGAGCCAGGG + Intronic
932021187 2:68088448-68088470 GCAAAACAGCTGTGGAGCCATGG - Intronic
933070867 2:77856928-77856950 TCCACAGAGCAGTGGAGCCCTGG - Intergenic
934161765 2:89256453-89256475 CCAATACATCTGTGGAACCAGGG - Intergenic
934205517 2:89925909-89925931 CCAATACATCTGTGGAACCAGGG + Intergenic
934632977 2:95950406-95950428 CCTATGCAGCAATGGGGCCACGG - Intronic
934752026 2:96799686-96799708 CCCCTGCAGCTGGGGAGCCATGG + Intronic
934800526 2:97152844-97152866 CCTATGCAGCAATGGGGCCATGG + Intronic
937192552 2:120118112-120118134 CCCATACAGTGCTGGAGGCAAGG - Intronic
937311946 2:120908144-120908166 CTCTTATAGCAGAGGAGCCATGG + Intronic
946321652 2:218958286-218958308 CCCTGACAGCAGTGGATCCTTGG + Intergenic
948335920 2:237207026-237207048 CCCGTGCTTCAGTGGAGCCAGGG + Intergenic
948669346 2:239557987-239558009 ACCATAAAGCAGTGAAGCAAAGG + Intergenic
948758161 2:240171376-240171398 CCCAGGGTGCAGTGGAGCCAGGG - Intergenic
948781459 2:240324230-240324252 CTCAAACAGCAGTGGGGCCCGGG + Intergenic
1171882327 20:30627659-30627681 CACACACAGCAGGGGAGCCCTGG - Intergenic
1173103880 20:40113110-40113132 GCCATCCAGCAATGCAGCCAAGG - Intergenic
1175240311 20:57542754-57542776 CCCAAACATCAGTAGTGCCAGGG - Intergenic
1175960849 20:62635598-62635620 CCCACACAGGAGTGTGGCCATGG + Intergenic
1176052033 20:63124906-63124928 CCAACACAGCTGTGGAGCCATGG + Intergenic
1176844553 21:13866590-13866612 TGCACACAGCAGTGGAGCCATGG + Intergenic
1176847286 21:13886153-13886175 TGCACACAGCAGTGGAGCCATGG + Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1178214949 21:30585142-30585164 CTCATACAGCTGTGGAGGCTCGG + Intergenic
1178730633 21:35099506-35099528 GCCATGCAGCTGTGGAGACAGGG + Intronic
1179221130 21:39408525-39408547 CCCAAACACCAGGTGAGCCAGGG + Intronic
1180839232 22:18951156-18951178 CTCATGCAGCCGTGGGGCCAGGG - Intergenic
1180876448 22:19177312-19177334 CCCAGGAAGCAGTGCAGCCAAGG + Intronic
1181062658 22:20289300-20289322 CTCATGCAGCCGTGGGGCCAGGG + Intergenic
1183301927 22:37062839-37062861 ACCATGCAGCAGGGGAGCCCGGG - Exonic
1184096564 22:42319365-42319387 CCCAGGCAGGAGTGGAGCCGGGG - Intronic
950703573 3:14766650-14766672 CTCATACAGCAGTGGGGACGAGG + Intronic
952589322 3:34932130-34932152 TGCATAGAGCAGAGGAGCCATGG - Intergenic
953552819 3:43917615-43917637 CAGATTCAGCAGTGGAGTCAAGG + Intergenic
956868203 3:73389851-73389873 CCCTAACAGCATTGCAGCCAAGG - Exonic
960412025 3:117338972-117338994 ACAACACAGCAGTGGAACCAAGG + Intergenic
960469259 3:118040605-118040627 CCCTCACATCAGTTGAGCCATGG + Intergenic
961726176 3:128932552-128932574 CCCATCCAGCAGGGTAGCCCAGG + Intronic
962841256 3:139234934-139234956 CTCATCCAGGAGTGGAGTCAGGG - Intronic
966780988 3:183584105-183584127 TACTTACAGGAGTGGAGCCAGGG - Intergenic
968574447 4:1358590-1358612 CAGATACTGCAGTGGTGCCACGG - Intronic
968703181 4:2066285-2066307 CCCACAGGGCAGTGCAGCCAAGG - Exonic
968939948 4:3632514-3632536 CCCAGACAGCCTTAGAGCCATGG - Intergenic
968963625 4:3758291-3758313 CCCATAGAGCAGTGGGGAAATGG + Intergenic
972569477 4:40297168-40297190 CTCATACAGCAGGGGTGCCAGGG - Intergenic
973365994 4:49210106-49210128 CACACACAGCAGGGGAGCCCTGG - Intergenic
973368050 4:49223484-49223506 TGCACACAGCAGTGGAGCCATGG + Intergenic
973393000 4:49571942-49571964 TGCACACAGCAGTGGAGCCATGG - Intergenic
973394604 4:49582345-49582367 CACACACAGCAGGGGAGCCCTGG + Intergenic
977949292 4:102951609-102951631 CCCAAACAGCAGTCTAGACATGG + Intronic
980036482 4:127888400-127888422 ACCATTCAGCAGAGGAGCCAGGG + Intronic
981227949 4:142318895-142318917 CCAATACAGCAGTGGAACATAGG + Intronic
1202765144 4_GL000008v2_random:142976-142998 TGCACACAGCAGTGGAGCCATGG + Intergenic
985545729 5:508077-508099 CCCTCACACCAGTGGAGCCAGGG + Intronic
985869821 5:2545411-2545433 CACATCCAGCAGTGGAGTCAGGG - Intergenic
986618763 5:9648130-9648152 TCCATACTGCTGTGTAGCCATGG - Intronic
987089747 5:14500281-14500303 GGCAGACAGGAGTGGAGCCAAGG - Intronic
992503831 5:77366542-77366564 CCCTGACAGCAGTGGAGCAGTGG - Intronic
994217545 5:97155364-97155386 AACATTCAGCAGTGAAGCCATGG + Intronic
995017385 5:107326276-107326298 GCCATACAGAAGTACAGCCAGGG - Intergenic
995425109 5:112012413-112012435 CCTAAACTGCAGTGGAACCAAGG - Intergenic
997696624 5:135866211-135866233 CCCACACAGCAGAGGAGGCTGGG + Intronic
1003986642 6:11442487-11442509 TCCATAGAGCAGGGGAGCCCTGG - Intergenic
1007163270 6:39810160-39810182 CCCAAACTGCAGTGGAGTCCGGG + Intronic
1012223434 6:96678610-96678632 CCTATAGAGCAGGGGAGTCAGGG - Intergenic
1014452385 6:121596307-121596329 TGCATACAGGGGTGGAGCCACGG + Intergenic
1014601665 6:123420519-123420541 CACATACAGCAGAGGAGACTGGG + Intronic
1018020441 6:159758410-159758432 CCAATACACCTGAGGAGCCAAGG - Intronic
1018941231 6:168309871-168309893 TCCAAACACCAGTGGATCCAGGG + Intronic
1018951734 6:168382777-168382799 CCCATCCAGCTGTGGACACAGGG + Intergenic
1020468733 7:8511433-8511455 GCCAGACAGCAGTGGAGCCCAGG - Intronic
1021168558 7:17370356-17370378 CCCAAACATCAGTAGTGCCAAGG - Intergenic
1022650255 7:32267476-32267498 CCCATCAAGCACTGGGGCCAAGG + Intronic
1029668128 7:102008960-102008982 TCCATACAGCAGGGGAGAGAAGG + Intronic
1030807553 7:113936422-113936444 CCTCTGCACCAGTGGAGCCAAGG + Intronic
1032038979 7:128542713-128542735 CCCATACAGTAGAAGACCCATGG - Intergenic
1033254570 7:139789034-139789056 CCCATACAGAATTGGAGAAAGGG - Intronic
1033674283 7:143522435-143522457 CGCAAACAGCAGTGTAGTCATGG + Intergenic
1033687059 7:143650611-143650633 CGCAAACAGCAGTGTAGTCATGG + Intronic
1033697552 7:143807012-143807034 CGCAAACAGCAGTGTAGTCATGG - Intergenic
1034469862 7:151249265-151249287 CACACACAGCAGTGGACGCAGGG - Intronic
1035424291 7:158757432-158757454 CCCTTAGGGCAGTGGAGCCAGGG + Intronic
1037523905 8:19706407-19706429 CTAAGAGAGCAGTGGAGCCACGG + Intronic
1039459146 8:37728859-37728881 CCCATACAGAACTGTACCCATGG + Intergenic
1042943353 8:74129939-74129961 CCCACTGAGCAGTGGAGGCATGG - Intergenic
1042984240 8:74565819-74565841 CCTATACAGCTGTGGAACCATGG - Intergenic
1044781791 8:95751078-95751100 CCAAGGGAGCAGTGGAGCCAGGG - Intergenic
1052758523 9:32566525-32566547 GCTATACAACAGAGGAGCCAAGG - Intronic
1055044850 9:71912931-71912953 TCCATACAGCTATGGAGACAGGG - Intronic
1056320220 9:85428793-85428815 CCCAGACAGCAGTAGACACACGG + Intergenic
1060485210 9:124042174-124042196 GCCAGAAAGCAGTGGAGCCAGGG + Intergenic
1061540965 9:131277656-131277678 CCCAGACTCCAGTAGAGCCAAGG - Intergenic
1062385776 9:136310970-136310992 ACCATGCAGCTGTGGAGCCTGGG + Intergenic
1203545892 Un_KI270743v1:127865-127887 TGCACACAGCAGTGGAGCCATGG + Intergenic
1191105146 X:56767965-56767987 TACATACAGCTGCGGAGCCAGGG - Intergenic
1191106139 X:56773367-56773389 TACATACAGCTGCGGAGCCAGGG - Intergenic
1191107132 X:56778769-56778791 TACATACAGCTGCGGAGCCAGGG - Intergenic
1191108665 X:56788497-56788519 TACATGCAGCTGTGGAGCCAGGG - Intergenic
1192382821 X:70635943-70635965 TCCACACTCCAGTGGAGCCACGG + Intronic
1194591416 X:95804660-95804682 ACCCTACAGCAGTGGTGGCATGG + Intergenic
1196525913 X:116727067-116727089 TGCACACAGCAGTGGAGCCCTGG - Intergenic
1200398000 X:156002525-156002547 CCCATCCTGCAGGGGAGTCAGGG - Intronic
1202586985 Y:26441121-26441143 CCTATGCAGCAATGGGGCCACGG + Intergenic