ID: 1063422139

View in Genome Browser
Species Human (GRCh38)
Location 10:5921472-5921494
Sequence GGCAAGTGGCCTTGTTGTCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063422134_1063422139 8 Left 1063422134 10:5921441-5921463 CCTAAAGGTGGCATTAGAGGTGA 0: 1
1: 0
2: 1
3: 16
4: 253
Right 1063422139 10:5921472-5921494 GGCAAGTGGCCTTGTTGTCCCGG 0: 1
1: 0
2: 0
3: 20
4: 178
1063422133_1063422139 9 Left 1063422133 10:5921440-5921462 CCCTAAAGGTGGCATTAGAGGTG 0: 1
1: 0
2: 0
3: 19
4: 639
Right 1063422139 10:5921472-5921494 GGCAAGTGGCCTTGTTGTCCCGG 0: 1
1: 0
2: 0
3: 20
4: 178
1063422129_1063422139 29 Left 1063422129 10:5921420-5921442 CCATAGAGTTTGTGCTCTCTCCC 0: 1
1: 0
2: 0
3: 19
4: 195
Right 1063422139 10:5921472-5921494 GGCAAGTGGCCTTGTTGTCCCGG 0: 1
1: 0
2: 0
3: 20
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063422139 Original CRISPR GGCAAGTGGCCTTGTTGTCC CGG Exonic
900099046 1:953192-953214 GGAAAGTGTCCTTCTTGTGCCGG + Exonic
902819505 1:18935348-18935370 AGCACGTGGCCTTGTTCTCCAGG - Intronic
902884274 1:19393594-19393616 GGCAGCTCGCCTTGTTGACCCGG - Intronic
902942974 1:19813839-19813861 GGCAAGTGTCCTGGTTGTTTAGG - Intergenic
906008768 1:42503188-42503210 GTGAAGTGGCATTGTTGTCAGGG + Intronic
908705332 1:66947753-66947775 TGCAGGTGGCCTTGCTGGCCTGG - Intronic
911181226 1:94862545-94862567 GGCAACTGGCTTCGTTGTTCTGG + Intronic
912805683 1:112755210-112755232 AGCATGTGGCCTTCTTGTCAAGG + Intergenic
913974660 1:143445652-143445674 GGCAGGTGGCCTTGTGGACGGGG + Intergenic
914226235 1:145721405-145721427 GGGAAGTGACCTTGGTGCCCGGG - Intronic
915272158 1:154760895-154760917 GGCCAGTGGCCTTGGTGGACAGG - Intronic
920183485 1:204146850-204146872 GGCAAGTGCCCTGGTGGGCCTGG - Intronic
921242885 1:213204818-213204840 GGCATCTCGCTTTGTTGTCCAGG + Intronic
922651234 1:227340878-227340900 TGCAAGAGGCCTTGTTGGCCAGG + Intergenic
923310435 1:232729601-232729623 GGCATTTGGCCATGTTGGCCAGG + Intergenic
1062768320 10:81715-81737 GGCAGGTGCCCTTGTTCTCTAGG + Intergenic
1063422139 10:5921472-5921494 GGCAAGTGGCCTTGTTGTCCCGG + Exonic
1064513429 10:16120337-16120359 GTGAAGTGGCATTGTTGTCTGGG - Intergenic
1067223001 10:44357338-44357360 GGCATGCGGCCTTGTTGTGCTGG - Intergenic
1069573596 10:69509020-69509042 GGCTGGAGGCCTTGTAGTCCTGG + Intergenic
1071937209 10:90545398-90545420 GGCATTTCGCCATGTTGTCCAGG - Intergenic
1075963337 10:126587970-126587992 GGCAAGTGGCCCTGTTCTGTGGG + Intronic
1076530392 10:131140877-131140899 GGCAAGAGGCCTGGCTGTGCAGG + Intronic
1076621879 10:131794198-131794220 GGCAAGTGGACTTTCTGTCTTGG - Intergenic
1076738137 10:132467856-132467878 GGCAGGTGGCCTTGGTGGACGGG - Intergenic
1077526661 11:3070067-3070089 GGCATTTTGCCATGTTGTCCAGG + Intergenic
1077541806 11:3150206-3150228 GGCAACTTGCCTTTTTGTACTGG - Intronic
1078391309 11:10937741-10937763 TGCAAGTGGCCTCTTTTTCCAGG - Intergenic
1078536008 11:12174927-12174949 GGCATTTTGCCATGTTGTCCAGG - Intronic
1079422472 11:20306685-20306707 GACAAGTGGGCATGTTGACCAGG - Intergenic
1080540868 11:33263505-33263527 GGGATGTTGCCATGTTGTCCAGG + Intronic
1082074827 11:47968119-47968141 GGCATTTTGCCTTGTTGCCCAGG + Intergenic
1082762348 11:57139562-57139584 GGCATTTGGCCATGTTGCCCAGG - Intergenic
1085421500 11:76365576-76365598 GGCATCTGGCCATGTTGCCCAGG + Intronic
1088584613 11:111351563-111351585 GGCTAGGGGGCTTGTTGTCCAGG - Intergenic
1093977406 12:25438321-25438343 GGCCAATGGCCTAGTTGTGCAGG - Intronic
1094223440 12:28019895-28019917 GGCATGTTGCTTTGTTGCCCAGG + Intergenic
1100470803 12:94891226-94891248 GGGATTTAGCCTTGTTGTCCAGG - Intergenic
1100862741 12:98823785-98823807 GGAAAGTGGCTTTTTTGGCCAGG - Intronic
1101967248 12:109290171-109290193 GGCAAGTGGCCGCGTGGACCTGG - Exonic
1102864910 12:116366751-116366773 GGCCAGTGGCCATGCTGTGCTGG + Intergenic
1103606185 12:122087640-122087662 GGCAAGGGGCCTTGTGGGCCAGG + Intronic
1114632394 14:24167534-24167556 GACAAGTGGCCTTGTGGTGAAGG - Intergenic
1120506886 14:85363947-85363969 GGTAAGTGGCTTTGTTTGCCAGG - Intergenic
1121700008 14:95945510-95945532 GGGATGTGGCCTTGTTGTGAAGG - Intergenic
1122577578 14:102751809-102751831 GGCATTTCGCCATGTTGTCCAGG + Intergenic
1124484312 15:30101850-30101872 TGCAGGTGGCCATGTTGGCCTGG - Intergenic
1124490690 15:30153192-30153214 TGCAGGTGGCCATGTTGGCCTGG - Intergenic
1124519270 15:30395374-30395396 TGCAGGTGGCCATGTTGGCCTGG + Intergenic
1124539385 15:30570847-30570869 TGCAGGTGGCCATGTTGGCCTGG - Intergenic
1124752843 15:32385137-32385159 TGCAGGTGGCCATGTTGGCCTGG + Intergenic
1124759265 15:32436725-32436747 TGCAGGTGGCCATGTTGGCCTGG + Intergenic
1124974583 15:34520836-34520858 TGCAGGTGGCCATGTTGGCCAGG + Intergenic
1128367076 15:67012099-67012121 GGCTGGTGGCCTTCCTGTCCAGG - Intergenic
1128637135 15:69309855-69309877 GGCATTTCACCTTGTTGTCCAGG - Intronic
1129895974 15:79106223-79106245 GTCAAGTGGGGTTGTTGTCAGGG - Intergenic
1130687776 15:86054060-86054082 GGCAAGGGGCTTTGTTCTCTTGG - Intergenic
1131076666 15:89499511-89499533 GGCAAACGGCCTTCTTGTGCTGG - Intergenic
1132185808 15:99800926-99800948 TGCAGGTGGCCATGTTGGCCTGG - Intergenic
1132429870 15:101751772-101751794 TGCAGGTGGCCATGTTGGCCTGG + Intergenic
1135541372 16:23332774-23332796 GAAAAGTGGCCTTGTTGGCCAGG + Intronic
1136012935 16:27376176-27376198 GGCATTTTGCCATGTTGTCCAGG + Intergenic
1136988400 16:35135249-35135271 GGCATATGACCCTGTTGTCCTGG + Intergenic
1138748455 16:59390940-59390962 GTGAAGTGGCATTGTTGTCTGGG + Intergenic
1139672630 16:68502132-68502154 AGCAAGTGGCCTTGCTGGGCTGG + Intergenic
1141640416 16:85337747-85337769 GGCAGGAGTCCTGGTTGTCCAGG + Intergenic
1141940200 16:87270832-87270854 GGCATTTCGCCATGTTGTCCAGG - Intronic
1142128467 16:88421577-88421599 GGCAAATGTCCCTGCTGTCCTGG + Intergenic
1142644062 17:1300780-1300802 GGTCAGTGGCCCTGCTGTCCCGG + Exonic
1143574153 17:7780135-7780157 AGCAAGTGGCATTGTTTTCCAGG + Exonic
1144381674 17:14705114-14705136 GGCCAGTGGTCTTGGTGTGCTGG + Intergenic
1144787889 17:17841957-17841979 CACAAGTGGCCTAGGTGTCCTGG + Intergenic
1146641783 17:34547332-34547354 GGGCAGTGGCCTTGTTTTGCAGG + Intergenic
1148641500 17:49191528-49191550 GGCAAGTGGCTTTTTTGTTTTGG + Intergenic
1149604849 17:57917224-57917246 AGCCACTGGCCTTGTTGCCCTGG - Intronic
1150432293 17:65127951-65127973 GGCAACTGGGCTTGTCCTCCGGG - Intergenic
1151194752 17:72423597-72423619 GGAAAGTGTCCATGTTGCCCAGG + Intergenic
1151553484 17:74835196-74835218 GGCATGTGGCTCTGTTTTCCTGG - Intronic
1152254157 17:79227725-79227747 GGCAGGTGGCCTCAGTGTCCAGG + Intronic
1153012425 18:551254-551276 GGGATTTGGCCATGTTGTCCAGG + Intergenic
1153015187 18:576826-576848 GTGAAGTGGCCTTGTTGCCTGGG - Intergenic
1155341813 18:24820777-24820799 GGCTAGTGGCCTTGTTTCTCAGG + Intergenic
1155950298 18:31904042-31904064 GGCATTTTGCCATGTTGTCCAGG - Intronic
1158308859 18:56137592-56137614 GTGAAGTGGCCTTGTTGCCATGG - Intergenic
1162807174 19:13144115-13144137 GGCAAATGGCTTTGGGGTCCTGG + Exonic
1163084311 19:14968475-14968497 GCCCCGTGGCCTTGTTGTCCAGG + Exonic
1165219733 19:34305615-34305637 GGCAAGTGCGCCTGTTGCCCAGG + Intronic
1165865395 19:38933914-38933936 GGAATCTGGCTTTGTTGTCCAGG + Intronic
1167098336 19:47387976-47387998 GGCATCTGGCCATGTTGCCCAGG + Intergenic
1167295699 19:48647873-48647895 GGCATTTGGCCATGTTGGCCGGG - Intergenic
928457908 2:31440362-31440384 GGGAAGTGGCCATTTTGACCAGG + Intergenic
929180126 2:39029432-39029454 GGCATCTGGCTATGTTGTCCAGG - Intronic
929948546 2:46388902-46388924 GGCAAGTCGCTTTGTTTTCCTGG - Intergenic
930504810 2:52269839-52269861 GGCATGTGGTCTTGATCTCCTGG - Intergenic
930504985 2:52272128-52272150 TGCATGTGGCCTTGAAGTCCTGG - Intergenic
932892455 2:75608943-75608965 AGCAAGTAGCTCTGTTGTCCAGG + Intergenic
933447106 2:82395549-82395571 GGGAAGTGGCATTGTTGTCTGGG + Intergenic
934179364 2:89606627-89606649 GGCAGGTGGCCTTGTGGACGGGG + Intergenic
934289650 2:91680890-91680912 GGCAGGTGGCCTTGTGGACGGGG + Intergenic
935748202 2:106208195-106208217 GTGAAGTGGCCTTGTTGTCTGGG + Intergenic
935784927 2:106540457-106540479 AGCAAGTCGGCTTGTTGTTCTGG + Intergenic
938303176 2:130230337-130230359 GGAAAGTGTCCTTCTTGTGCCGG - Intergenic
938453494 2:131443900-131443922 GGAAAGTGTCCTTCTTGTGCCGG + Intergenic
939930799 2:148230801-148230823 AGCAGGTTGCCTTGTTGCCCAGG + Intronic
944492107 2:200268205-200268227 GGCAACTGCCCTTGGTATCCTGG + Intergenic
945040713 2:205741638-205741660 GGCAAGTTGCCTCTTTGACCTGG + Intronic
948180314 2:235974157-235974179 GTTAAGTGGCTTTCTTGTCCAGG + Intronic
948850587 2:240703604-240703626 GGCTTGTGGCCTTGCTTTCCTGG + Intergenic
949047722 2:241879741-241879763 GGCAAGTGTCCCTGTTTGCCTGG + Intergenic
1168992217 20:2104111-2104133 GGCAAGAGGTCTTGCAGTCCTGG + Intronic
1169430676 20:5533275-5533297 GGCCAGTGGTCTTGCTGTGCTGG - Intergenic
1172971992 20:38880473-38880495 GGCATTTTGCCATGTTGTCCAGG - Intronic
1173523161 20:43713759-43713781 GGCCAGTGGACTTGCTGTGCCGG + Intronic
1173956471 20:47036862-47036884 GGCAAGGGGCTTTGTTTTTCTGG + Intronic
1174298440 20:49565472-49565494 GGCATCTTGCCATGTTGTCCAGG - Intronic
1175218857 20:57405625-57405647 AGCAAGAGGCCCTGTCGTCCAGG + Intronic
1176600512 21:8789211-8789233 GCCATGTTGCCTTGATGTCCTGG + Intergenic
1178641503 21:34348266-34348288 GGGATGTCGCCATGTTGTCCAGG - Intergenic
1179719771 21:43308391-43308413 GGCAAGAGGCCTGGCTGTCCTGG - Intergenic
1180056100 21:45359948-45359970 TGCAGGTGGTCTTGGTGTCCAGG + Intergenic
1180916789 22:19494407-19494429 GGCAAGTGGGCTTCTGGTGCTGG - Intronic
1181130829 22:20730983-20731005 GGCGTCTTGCCTTGTTGTCCAGG - Intronic
1182094847 22:27619213-27619235 GGCAAGTTACCTTGTTGCCCAGG + Intergenic
1182612408 22:31559879-31559901 GGCCAGTGGTCTTGGTGTGCTGG - Intronic
1184264737 22:43341127-43341149 GGCAGGTGGCATTGCTTTCCGGG + Intronic
1185050106 22:48549888-48549910 GGGAATTGGACTTGTGGTCCTGG + Intronic
950389955 3:12688828-12688850 GGGGACTGGCCATGTTGTCCAGG - Intergenic
953937221 3:47056148-47056170 GGCATCTTGCCCTGTTGTCCAGG + Intronic
954084917 3:48236714-48236736 CTGAAGTGGCCTTGTTGTCTGGG - Intergenic
955082612 3:55672144-55672166 GGCATCTTGCCATGTTGTCCAGG - Intronic
959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG + Intronic
967771256 3:193335815-193335837 TGCAAGTGGCCTAGTTGAGCTGG - Intronic
968645809 4:1740011-1740033 GGCACGTGGCCTCGGTGGCCCGG - Intronic
973214029 4:47648938-47648960 GGGAAGGGGCTTTGTTGTCCAGG - Intronic
973363944 4:49191959-49191981 GCCATGTTGCCTTGATGTCCTGG + Intergenic
973397138 4:49604784-49604806 GCCATGTTGCCTTGATGTCCTGG - Intergenic
975766256 4:77670790-77670812 GTGAAGTGGCGTTGTTGTCTGGG - Intergenic
976611404 4:87034306-87034328 GGAATGGGGCCTTGTTGGCCAGG + Intronic
977284657 4:95087537-95087559 GGCATTTCGCCATGTTGTCCAGG - Intronic
978289700 4:107123155-107123177 TGCTAGTGGCATTGCTGTCCTGG + Intronic
980935597 4:139222662-139222684 TGCAAGTGGACTCATTGTCCAGG - Intergenic
983665677 4:170179678-170179700 GGCAAGTGGACTTGCTGTTGGGG + Intergenic
987303791 5:16618914-16618936 GGAAAGTGGCCTGGGTGTCAAGG + Intergenic
993902128 5:93591602-93591624 GGGAAGTGACCTTGTACTCCAGG + Intronic
994549935 5:101221145-101221167 GGCATCTTGCTTTGTTGTCCAGG + Intergenic
997697495 5:135873094-135873116 GGGAAGTGGCCCCATTGTCCTGG + Intronic
998328969 5:141306530-141306552 GGCATTTTGCCATGTTGTCCAGG - Intergenic
999125014 5:149240138-149240160 GGCAGGTGGCCCTGTGGCCCTGG + Intronic
1002189631 5:177471997-177472019 GGCAAGTGGCCGGCTTGGCCTGG - Intronic
1002894402 6:1367973-1367995 GGGATGTGGCCATGTTGCCCAGG + Intergenic
1005064703 6:21807111-21807133 GGCATGTGGCCTAGTTCTTCAGG - Intergenic
1006313276 6:33276406-33276428 GGCCAGTGGTCTTGGTGTGCTGG - Exonic
1007338363 6:41171711-41171733 GTGAAGTGACCTTGTTGTCTGGG + Intergenic
1007477330 6:42127596-42127618 GGCAAGGGGCCTTTCAGTCCAGG + Intronic
1010786117 6:80003882-80003904 GCTAAGTGGCTTTGTGGTCCAGG - Intronic
1013631259 6:111988237-111988259 GTGAAGTGGCCTTGTTGTCTAGG - Intergenic
1014099161 6:117490429-117490451 GGAAAGTGGAATTTTTGTCCAGG + Intronic
1015301916 6:131662431-131662453 GGCATTTTGCCATGTTGTCCAGG + Intronic
1017588893 6:155957120-155957142 GGCAAGTGGGCTGGTTGCCCTGG + Intergenic
1019285048 7:219197-219219 AGCATGTGACTTTGTTGTCCAGG + Intronic
1021820997 7:24497387-24497409 CTGAAGTGGCCTCGTTGTCCGGG - Intergenic
1022663209 7:32385826-32385848 GGGAACTGGCCTTGTTCACCAGG + Intergenic
1023009878 7:35917059-35917081 TGCACCTGGCCTTGTTGTCGTGG + Intergenic
1024080956 7:45854549-45854571 TGCACCTGGCCTTGTTGTCGTGG - Intergenic
1024084009 7:45878664-45878686 GGCAAATGGCTTTGTGGGCCAGG - Intergenic
1024667300 7:51559584-51559606 GGCAAGTGGCCCTCTTCTCACGG - Intergenic
1025123539 7:56327250-56327272 TGCACCTGGCCTTGTTGTCGTGG + Intergenic
1025716684 7:63963511-63963533 GGCATATGACCCTGTTGTCCTGG - Intergenic
1025847793 7:65216494-65216516 TGCACCTGGCCTTGTTGTCGTGG + Intergenic
1025898043 7:65722363-65722385 TGCACCTGGCCTTGTTGTCGTGG + Intergenic
1029144055 7:98433396-98433418 TGCACCTGGCCTTGTTGTCGTGG + Intergenic
1032546714 7:132749957-132749979 TGCAAGTGACCTGGTGGTCCCGG - Intergenic
1033345112 7:140520401-140520423 GCCAAGTGGCTTAGTTTTCCAGG + Intronic
1035113705 7:156505666-156505688 GGCGAGTGGGCTGGGTGTCCTGG - Intergenic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1040957678 8:52996073-52996095 GTGAAGTGGCCTTGTTGTCTGGG - Intergenic
1047827668 8:128594933-128594955 GTGAAGTGGTCTTGTTGTCTGGG - Intergenic
1049018184 8:139936347-139936369 AGCATGTGGCCTTGTGCTCCTGG - Intronic
1052147093 9:25062751-25062773 GTCATGTGGGTTTGTTGTCCAGG + Intergenic
1054830776 9:69622208-69622230 GGCAAGTGGGCTTATTCTGCTGG - Intronic
1060030835 9:120213534-120213556 GGGAGGTGGCCCTGATGTCCAGG - Intergenic
1060749729 9:126161397-126161419 GGCGATTTGCCATGTTGTCCAGG + Intergenic
1061060666 9:128248802-128248824 TGCAGGTGGCCATGTTGGCCTGG + Intronic
1061206087 9:129164278-129164300 GGCCAGTGGCCTTCTTGTTCTGG + Intergenic
1061612276 9:131755016-131755038 AGCAAGAGGCCTTGTTGTTCTGG - Intergenic
1062402252 9:136377836-136377858 GGGAGGTGGCCTTGTGCTCCAGG + Exonic
1185977125 X:4733866-4733888 GGCATTTTCCCTTGTTGTCCAGG - Intergenic
1186116623 X:6310763-6310785 GTGAAGTGGCCTCGTTGTCTGGG + Intergenic
1186165475 X:6822200-6822222 GTGAAGTGGCATTGTTGTCTGGG - Intergenic
1188849718 X:35116618-35116640 TTGAAGTGGCCTTGTTGTCTGGG - Intergenic
1189532733 X:41903018-41903040 GGGAAGTGGTCTTCTAGTCCAGG - Intronic
1190051876 X:47156643-47156665 GGGAGGAGGCCTTGTTGGCCAGG + Intronic
1190238574 X:48637006-48637028 GGCATATGACCCTGTTGTCCTGG + Intergenic
1190266430 X:48829780-48829802 GGCAGGTGGCCTTCTGGTGCCGG - Exonic
1190299685 X:49049830-49049852 GGGATCTGGCCATGTTGTCCAGG + Intergenic
1194350126 X:92816701-92816723 ATGAAGTGGCCTTGTTGTCTGGG - Intergenic
1197891238 X:131272836-131272858 GGCAAGTGGCCTTCTAATCCAGG + Intergenic
1201607515 Y:15803398-15803420 TGCAAGTGGCCTCTTTCTCCCGG - Intergenic
1201706243 Y:16940234-16940256 AGGAACTGGCTTTGTTGTCCAGG - Intergenic