ID: 1063423822

View in Genome Browser
Species Human (GRCh38)
Location 10:5935888-5935910
Sequence GCACTCACGCCTGGCACGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 119}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063423822_1063423825 -6 Left 1063423822 10:5935888-5935910 CCCTGCGTGCCAGGCGTGAGTGC 0: 1
1: 0
2: 1
3: 4
4: 119
Right 1063423825 10:5935905-5935927 GAGTGCTTTGCATGCATTGAAGG No data
1063423822_1063423826 -5 Left 1063423822 10:5935888-5935910 CCCTGCGTGCCAGGCGTGAGTGC 0: 1
1: 0
2: 1
3: 4
4: 119
Right 1063423826 10:5935906-5935928 AGTGCTTTGCATGCATTGAAGGG No data
1063423822_1063423828 26 Left 1063423822 10:5935888-5935910 CCCTGCGTGCCAGGCGTGAGTGC 0: 1
1: 0
2: 1
3: 4
4: 119
Right 1063423828 10:5935937-5935959 CCTCAGCAGCCACCTGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063423822 Original CRISPR GCACTCACGCCTGGCACGCA GGG (reversed) Intronic
901098573 1:6701920-6701942 GCACTCCCGCCGGGCGCGGACGG - Exonic
904035630 1:27557142-27557164 GCCCACACACCTGGCACCCAGGG - Intronic
906296932 1:44654675-44654697 GGAGGCACGCCTGGCACGCCGGG - Exonic
907514987 1:54988237-54988259 GCACTCACGCCTGGCTGGGTGGG - Intronic
908272753 1:62436894-62436916 CCACTCGCCCCTGGCACGCACGG - Exonic
916043392 1:160980470-160980492 GCACTCTCGCCTGGGAGACAGGG + Intergenic
920009718 1:202859063-202859085 GCACTCCGGCCTGGCCCACATGG + Intergenic
922816852 1:228455281-228455303 GCACTCCAGCCTGGGACACAGGG + Intergenic
923008174 1:230067981-230068003 GCACTGGCCCCTGGCTCGCACGG - Intronic
923967270 1:239155890-239155912 GCACTCTCTCCTGGCAGTCAGGG - Intergenic
1063423822 10:5935888-5935910 GCACTCACGCCTGGCACGCAGGG - Intronic
1064412618 10:15120421-15120443 GCACTCAAGCCTGGGAGACAGGG + Intronic
1064442588 10:15367439-15367461 GCCCTCACACCTGGCTTGCAAGG + Intronic
1066236643 10:33491269-33491291 GCAGTCACCCCTGGCACGCATGG + Intergenic
1070141513 10:73741530-73741552 GCACTCCAGCCTGGGACACAGGG - Intergenic
1070236583 10:74634237-74634259 GCACTCCAGCCTGGAAGGCAGGG - Intronic
1072585650 10:96779383-96779405 GCAACCACGCCTGGCACCCTAGG + Intergenic
1077257318 11:1592436-1592458 GCACTCCCGCCTGGGCAGCAAGG + Intergenic
1077443630 11:2580136-2580158 CCCCTTACGCTTGGCACGCAAGG + Intronic
1077840808 11:5972661-5972683 GCACTCCAGCCTGGCTCTCATGG - Intergenic
1083768594 11:64854048-64854070 GCACACAGGGCTGGCACACAGGG + Exonic
1084509590 11:69594915-69594937 TCACTCACGCCCTGCAAGCAGGG - Intergenic
1091428727 12:414124-414146 GCACTCCAGCCTGGCAGACAGGG - Intronic
1092233679 12:6792278-6792300 GCCCTCACCCCTGGCCCCCAGGG - Intronic
1092262788 12:6961394-6961416 GCTTTCACGCGAGGCACGCACGG - Intergenic
1092886836 12:12932101-12932123 GCCACCACGCCTGGCCCGCATGG + Intergenic
1093023332 12:14222582-14222604 GCACTCCAGCCTGGGAGGCAGGG - Intergenic
1101479503 12:105083911-105083933 GCGCTCGAGACTGGCACGCAGGG - Intronic
1102182424 12:110922633-110922655 GCACTCAGGCCTGCCACCCACGG - Intergenic
1102720390 12:115010907-115010929 GCTCTCACTCTTGGCACACAGGG - Intergenic
1103508978 12:121461161-121461183 ACTCCCACCCCTGGCACGCAGGG - Intronic
1104020722 12:124990246-124990268 GCACTCTGGCCTGGCCCACAGGG - Intergenic
1104924869 12:132308852-132308874 GCACTCACGCCTTACCCACAGGG + Intronic
1106722057 13:32445214-32445236 GCACTCCAGCCTGGCCCACAGGG + Intronic
1112679096 13:101741299-101741321 GCACTCCAGCCTGGCAGACAGGG + Intronic
1113187949 13:107711368-107711390 GCACTCCCGCCTGGGAGACAGGG - Intronic
1121638623 14:95470614-95470636 GCACTCAAGCCTGGGCAGCAGGG + Intronic
1121663595 14:95654516-95654538 GCACTCTGGCCTGGCACAGAGGG - Intergenic
1122147258 14:99699016-99699038 GCACTCAAGCCGGGCAGTCAAGG - Intronic
1123999228 15:25740906-25740928 GCACCCATTCCTGCCACGCAGGG + Intronic
1126150911 15:45522860-45522882 ACACGCAGGCCTGGCGCGCAGGG + Intergenic
1130322029 15:82849668-82849690 GCACACACGCTTGGGACTCACGG + Exonic
1131159747 15:90097903-90097925 GCACTCACTCATGGCAAGGATGG + Intronic
1140996345 16:80263327-80263349 ACACTCTCGACTGGCACGGAGGG - Intergenic
1141154321 16:81586554-81586576 GCACTGTAGCCTGCCACGCAAGG + Intronic
1141719224 16:85746313-85746335 GCACTCAAGCCTGGGCGGCAAGG + Intronic
1142226643 16:88880869-88880891 ACACTCACGCCCTGCACTCAGGG - Intronic
1142325989 16:89414977-89414999 GCACTCCAGCCTGGGCCGCAGGG - Intronic
1146364851 17:32214939-32214961 GCACTCCCGCCTGGGTGGCAGGG - Intronic
1146368641 17:32249880-32249902 GCACTCCAGCCTGGGAGGCAGGG - Intronic
1147851570 17:43447717-43447739 GCACTCCAGCCTGGGAGGCAGGG - Intergenic
1152469424 17:80482633-80482655 GCCCTCACGCATGGTACCCAAGG - Intergenic
1155259085 18:24024046-24024068 GCACTCCAGCCTGGGAGGCAAGG - Intronic
1160045166 18:75379697-75379719 ACACTCACCCCTGGCACTCTTGG + Intergenic
1160736141 19:663213-663235 ACGCTCACGCACGGCACGCACGG + Exonic
1161363215 19:3863199-3863221 GCAGCCACACCTGGCAGGCAGGG + Intronic
1164562855 19:29304778-29304800 GCTCTCAGACCTGGCACCCATGG - Intergenic
1168410077 19:56134321-56134343 GCCCTCAGGCCTGGGAAGCAGGG + Intronic
925878776 2:8333299-8333321 CAACTCAGGCCTGGCACACAGGG + Intergenic
927518842 2:23687390-23687412 GCACCCAAGCCTGGCAAGGACGG + Intronic
930959223 2:57238796-57238818 GCACTCCAGCCTGGGCCGCAGGG - Intergenic
931172150 2:59814755-59814777 GCACACACTCCTGGCTTGCAGGG + Intergenic
931788497 2:65642660-65642682 GCACTCAAGCCTGGGCCACAGGG + Intergenic
932993457 2:76817181-76817203 GCATGCACTCCTGGCACTCATGG - Intronic
945521052 2:210827781-210827803 GCACTCCAGCCTGGCAGACAGGG - Intergenic
947447093 2:230172445-230172467 ACACTCAAGCCTGGCAGGCAGGG - Intronic
948152761 2:235757359-235757381 GCACTAGCACCTGGCACACAGGG - Intronic
1169782479 20:9324223-9324245 GCTCTCACGCCTGGCCAACATGG + Intronic
1170582403 20:17709339-17709361 GCACTGAGGCCTAGCAGGCAAGG + Intronic
1172764091 20:37341839-37341861 GAAGCCACGCCTGGCACTCAGGG + Intergenic
1178810765 21:35879005-35879027 GCTCTCACCACTGGCATGCAAGG + Intronic
1182451442 22:30424152-30424174 GGACTCACACTTGGCTCGCACGG - Exonic
1182902115 22:33907231-33907253 GCACTCACGCCTGGCTTACAAGG + Intronic
1184150611 22:42636180-42636202 GCACTCCAGCCTGGGACACAGGG + Intronic
951554708 3:23909490-23909512 GCACTCAAGCCTGGGAGACAGGG + Intronic
953877411 3:46674176-46674198 TCAATCACGGCTGGCACTCAGGG + Intronic
954322119 3:49839410-49839432 GCACGCACTCCTGGCACTAAGGG + Intronic
961376502 3:126469628-126469650 GCACTCAAGCCTGCCACTCCTGG + Intronic
965530611 3:169766844-169766866 GCACTCCAGCCTGGGACACAGGG + Intergenic
968147514 3:196311924-196311946 GCACTCAAGCCTGGCCAACAAGG - Intronic
969107735 4:4820538-4820560 CCACTCTGGCCTGGCACGCCTGG - Intergenic
976745565 4:88399732-88399754 GCACTCCAGCCTGGCGCACAGGG + Intronic
983305488 4:165979753-165979775 GCACTCAAGCCTGGGTGGCAAGG + Intronic
984425215 4:179574890-179574912 CCACTGACTCCTGGCATGCATGG - Intergenic
985318857 4:188686774-188686796 GCCACCACGCCTGGCCCGCATGG + Intergenic
985734325 5:1569311-1569333 GCACTCCAGCCTGGCCGGCATGG + Intergenic
988801342 5:34699003-34699025 GCACTCACACTTGGCTGGCACGG - Intronic
990578446 5:57146261-57146283 GCACTCTCTCCTGGCATGGAAGG + Intergenic
996183657 5:120451075-120451097 CCACTCACCCTTGGCAGGCATGG - Intergenic
997429166 5:133825683-133825705 GCACTCAAGCATGGGACGCCAGG - Intergenic
998112684 5:139514315-139514337 GCACCCTAGCCTGGCAGGCAGGG + Intergenic
1006755773 6:36413962-36413984 GCACTCAAGCCTGGGAAACAGGG + Intronic
1010214589 6:73390142-73390164 GCACTCCAGCCTGGCCCACAGGG + Intronic
1013190108 6:107795560-107795582 GCACTCAAGCCTGGGAGACAGGG - Intronic
1018226887 6:161637279-161637301 CCATTAACGCCTGGCAGGCAAGG + Intronic
1020089842 7:5332914-5332936 GCACCCACGCCTGGCGCCCGCGG - Exonic
1022462881 7:30628217-30628239 GCACTCCAGCCTGGAAGGCAAGG - Intronic
1026496150 7:70905201-70905223 GCACTGAAGCCTGGGAAGCATGG + Intergenic
1035198359 7:157241844-157241866 GCACTGACACATGGCACACATGG + Intronic
1036992522 8:13614893-13614915 GCACTCCAGCCTGGGACACAAGG - Intergenic
1037890306 8:22620597-22620619 GCACACACCCCTGGCATGCTGGG + Exonic
1038234222 8:25736011-25736033 GCACCCACACCTGGCTCGGAGGG - Intergenic
1038407765 8:27334691-27334713 ACACTCATGCCTGGCTCACACGG + Intronic
1043218835 8:77632167-77632189 GCACTCTAGCCTGGGACACAGGG - Intergenic
1044774825 8:95677425-95677447 GCACTCACCCTGGGCAGGCATGG - Intergenic
1045356603 8:101395039-101395061 GCACTCACACCTGGGAAGAAAGG + Intergenic
1046023767 8:108697973-108697995 GCACTCAGGGCAGGCACTCAGGG - Intronic
1048408843 8:134150798-134150820 TCACTCATGCCTGGCACCCTGGG + Intergenic
1048889202 8:138932874-138932896 TCACTCACGCCTGGAGCTCAGGG + Intergenic
1053227339 9:36371963-36371985 GCACTCCAGCCTGGCAGACAGGG - Intronic
1055027207 9:71735185-71735207 GCACTCACCCCTTGAAGGCAGGG - Intronic
1057054687 9:91951133-91951155 GGCCTCACGTCTGGCACCCAAGG - Intergenic
1057576580 9:96247292-96247314 GCAATCAGGCCTGGCAGGCCTGG + Intronic
1060598544 9:124862550-124862572 GCACTCCAGCCTGGCACCCTGGG - Intronic
1060664920 9:125427155-125427177 GCCCGCACGCCCCGCACGCATGG - Intergenic
1060972227 9:127744840-127744862 CCACTCTCGGCTGCCACGCACGG + Exonic
1061436912 9:130569508-130569530 GCACTCCAGCCTGGGACACAGGG + Intergenic
1062212995 9:135374521-135374543 GCCCTCAGCCCTGGCACGCCTGG - Intergenic
1062577695 9:137216225-137216247 GCAATGAGGCCTGGCACTCAGGG - Intronic
1062683641 9:137798746-137798768 GCACTCAGGGCTGGCACACCAGG + Intronic
1186143424 X:6601324-6601346 GCACTCCAGCCTGGGAAGCAGGG - Intergenic
1187294681 X:17987136-17987158 GCACTCACTTCTGGCACAGATGG + Intergenic
1190244510 X:48682379-48682401 GCACTCACACCTGGCCTGCCTGG + Intronic
1191204191 X:57816920-57816942 GCCATCACACCTGGCACACATGG + Intergenic
1201077197 Y:10196996-10197018 TCACTCACAGCTGCCACGCACGG + Intergenic