ID: 1063429824

View in Genome Browser
Species Human (GRCh38)
Location 10:5978176-5978198
Sequence TAGGGGAGCAAAGCTGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 251}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063429824_1063429840 23 Left 1063429824 10:5978176-5978198 CCTGCTGCAGCTTTGCTCCCCTA 0: 1
1: 0
2: 1
3: 17
4: 251
Right 1063429840 10:5978222-5978244 GAGGGGGCGGAGGGGGGAGAAGG No data
1063429824_1063429830 5 Left 1063429824 10:5978176-5978198 CCTGCTGCAGCTTTGCTCCCCTA 0: 1
1: 0
2: 1
3: 17
4: 251
Right 1063429830 10:5978204-5978226 TGCCTCATCTTAGAAGGAGAGGG No data
1063429824_1063429838 16 Left 1063429824 10:5978176-5978198 CCTGCTGCAGCTTTGCTCCCCTA 0: 1
1: 0
2: 1
3: 17
4: 251
Right 1063429838 10:5978215-5978237 AGAAGGAGAGGGGGCGGAGGGGG No data
1063429824_1063429836 14 Left 1063429824 10:5978176-5978198 CCTGCTGCAGCTTTGCTCCCCTA 0: 1
1: 0
2: 1
3: 17
4: 251
Right 1063429836 10:5978213-5978235 TTAGAAGGAGAGGGGGCGGAGGG No data
1063429824_1063429839 17 Left 1063429824 10:5978176-5978198 CCTGCTGCAGCTTTGCTCCCCTA 0: 1
1: 0
2: 1
3: 17
4: 251
Right 1063429839 10:5978216-5978238 GAAGGAGAGGGGGCGGAGGGGGG No data
1063429824_1063429842 25 Left 1063429824 10:5978176-5978198 CCTGCTGCAGCTTTGCTCCCCTA 0: 1
1: 0
2: 1
3: 17
4: 251
Right 1063429842 10:5978224-5978246 GGGGGCGGAGGGGGGAGAAGGGG No data
1063429824_1063429829 4 Left 1063429824 10:5978176-5978198 CCTGCTGCAGCTTTGCTCCCCTA 0: 1
1: 0
2: 1
3: 17
4: 251
Right 1063429829 10:5978203-5978225 ATGCCTCATCTTAGAAGGAGAGG No data
1063429824_1063429837 15 Left 1063429824 10:5978176-5978198 CCTGCTGCAGCTTTGCTCCCCTA 0: 1
1: 0
2: 1
3: 17
4: 251
Right 1063429837 10:5978214-5978236 TAGAAGGAGAGGGGGCGGAGGGG No data
1063429824_1063429835 13 Left 1063429824 10:5978176-5978198 CCTGCTGCAGCTTTGCTCCCCTA 0: 1
1: 0
2: 1
3: 17
4: 251
Right 1063429835 10:5978212-5978234 CTTAGAAGGAGAGGGGGCGGAGG No data
1063429824_1063429834 10 Left 1063429824 10:5978176-5978198 CCTGCTGCAGCTTTGCTCCCCTA 0: 1
1: 0
2: 1
3: 17
4: 251
Right 1063429834 10:5978209-5978231 CATCTTAGAAGGAGAGGGGGCGG No data
1063429824_1063429841 24 Left 1063429824 10:5978176-5978198 CCTGCTGCAGCTTTGCTCCCCTA 0: 1
1: 0
2: 1
3: 17
4: 251
Right 1063429841 10:5978223-5978245 AGGGGGCGGAGGGGGGAGAAGGG No data
1063429824_1063429828 -1 Left 1063429824 10:5978176-5978198 CCTGCTGCAGCTTTGCTCCCCTA 0: 1
1: 0
2: 1
3: 17
4: 251
Right 1063429828 10:5978198-5978220 AGAAAATGCCTCATCTTAGAAGG No data
1063429824_1063429831 6 Left 1063429824 10:5978176-5978198 CCTGCTGCAGCTTTGCTCCCCTA 0: 1
1: 0
2: 1
3: 17
4: 251
Right 1063429831 10:5978205-5978227 GCCTCATCTTAGAAGGAGAGGGG No data
1063429824_1063429833 7 Left 1063429824 10:5978176-5978198 CCTGCTGCAGCTTTGCTCCCCTA 0: 1
1: 0
2: 1
3: 17
4: 251
Right 1063429833 10:5978206-5978228 CCTCATCTTAGAAGGAGAGGGGG No data
1063429824_1063429843 26 Left 1063429824 10:5978176-5978198 CCTGCTGCAGCTTTGCTCCCCTA 0: 1
1: 0
2: 1
3: 17
4: 251
Right 1063429843 10:5978225-5978247 GGGGCGGAGGGGGGAGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063429824 Original CRISPR TAGGGGAGCAAAGCTGCAGC AGG (reversed) Intronic
901198373 1:7453067-7453089 TGAGGCAGCAAAGCTGCTGCTGG + Intronic
901720010 1:11189498-11189520 GAGGTCTGCAAAGCTGCAGCAGG - Exonic
902596928 1:17516081-17516103 TAGGTGGGCACAGCTGCTGCTGG + Intergenic
903417907 1:23196942-23196964 AATGGGAGCAAAACTTCAGCCGG - Intergenic
903970722 1:27117231-27117253 TAGGGGAGCAGAGCTCCTACAGG + Intronic
904107214 1:28095867-28095889 TGGGAGAACAAAGCAGCAGCGGG - Intergenic
905051867 1:35058651-35058673 TAGGGGAACAACACAGCAGCAGG + Intergenic
905432147 1:37931982-37932004 TAGGTGCGCAGAGCTGGAGCTGG - Exonic
905958971 1:42027350-42027372 TAGGGCAGCTAAGGTGAAGCAGG - Intronic
906955423 1:50370042-50370064 TATGGGAGGAAGGCTGCACCTGG + Intergenic
907936651 1:59047778-59047800 CAGGGAAGCAAACCAGCAGCAGG + Intergenic
909818052 1:80021766-80021788 TAGGGGAGCAATGCTGCTTTAGG + Intergenic
910186221 1:84543489-84543511 AGGGGGAGCAAGGCTGGAGCAGG + Intergenic
910705773 1:90128278-90128300 GAGGAGAGCAAAACTGGAGCAGG + Intergenic
912989720 1:114473400-114473422 TAGGGGAACAACACAGCAGCAGG - Intronic
913002021 1:114590314-114590336 TAGGGGATAAAGGCTGCAGTGGG + Intronic
913064440 1:115237591-115237613 TAGGGGAACAACACAGCAGCAGG - Intergenic
913611539 1:120514117-120514139 TTGGGGAGCTAGTCTGCAGCAGG - Intergenic
914579653 1:149008122-149008144 TTGGGGAGCTAGTCTGCAGCAGG + Intronic
916795339 1:168161862-168161884 TAGGGCAGCATAGAGGCAGCTGG - Intergenic
918179132 1:182070772-182070794 TGTGAGAGCAAACCTGCAGCTGG - Intergenic
922677817 1:227563570-227563592 TACGGGACCAAAGCTCCAGCTGG - Exonic
1063249439 10:4258051-4258073 TGGAAGAGCAAAGCCGCAGCAGG + Intergenic
1063429824 10:5978176-5978198 TAGGGGAGCAAAGCTGCAGCAGG - Intronic
1063620404 10:7641936-7641958 TTGGTGATGAAAGCTGCAGCTGG + Exonic
1063824408 10:9878163-9878185 TAGGGGAGAAAAGCCTCAGATGG + Intergenic
1065846158 10:29745261-29745283 TACTGGACCAACGCTGCAGCAGG - Intergenic
1065992145 10:31022226-31022248 TAGTGGATCAGAGCGGCAGCAGG - Intronic
1067151310 10:43737173-43737195 TTTGGGAGCACAGCTGGAGCTGG + Intergenic
1070586657 10:77771766-77771788 TAGAGGAGCAAAGCTGCTTCCGG - Intergenic
1071209923 10:83328909-83328931 TGTGGGAGCAAAGCTGCAACGGG - Intergenic
1073281829 10:102360180-102360202 TAGGGGACCAAAGCTGTGCCTGG - Exonic
1075347669 10:121696097-121696119 TGGGGGAGCTCAGCTGCGGCTGG - Intergenic
1076188348 10:128465926-128465948 TTGGGGATCAAAGCTGAGGCAGG - Intergenic
1077632604 11:3821230-3821252 AAGGTGAGCAATGCTGCAGGCGG - Intronic
1078159530 11:8828667-8828689 GAGGTGAGCAAAGCTCCAGAAGG + Intronic
1078582303 11:12547899-12547921 TAAGGGAGCAAAGACACAGCTGG - Intergenic
1079271218 11:18987639-18987661 TAGGGGAACAACACAGCAGCAGG - Intergenic
1080016427 11:27511474-27511496 TAGGGTAGCAGACATGCAGCTGG + Intergenic
1080417086 11:32078867-32078889 GAGGGGAAGATAGCTGCAGCAGG + Intronic
1080831081 11:35893963-35893985 TAGGGGAGCAGGGAGGCAGCTGG - Intergenic
1080952711 11:37054496-37054518 AAGGGGAGCAAAGTTGCAGAGGG - Intergenic
1081759663 11:45568462-45568484 TAGAGGAGGGAAGCTCCAGCGGG - Intergenic
1083625170 11:64068710-64068732 GAGGGCAGAGAAGCTGCAGCTGG + Intronic
1084516549 11:69640879-69640901 GCGGGGAGAAAGGCTGCAGCGGG + Intergenic
1084860057 11:72012314-72012336 TGGCGGAGGCAAGCTGCAGCCGG + Intronic
1085231672 11:74976896-74976918 TGGGAGAACAAAGCAGCAGCGGG + Exonic
1085702449 11:78756941-78756963 TAGGGGAGCCAAGGCACAGCGGG + Exonic
1087832008 11:102829684-102829706 CAGGGGAGGAAAGCAGAAGCTGG - Intergenic
1087882653 11:103436704-103436726 TAGGGGTTCAAAGGTGGAGCAGG - Intronic
1089201712 11:116728526-116728548 TGGGGATGCAAAGCTGCAGATGG - Intergenic
1090889858 11:130914377-130914399 TAGGGGCTCAAAGCTGAAGGTGG + Exonic
1091239040 11:134040196-134040218 CAGCGGAGCACAGCCGCAGCAGG + Intergenic
1091544332 12:1491131-1491153 TACTGGGGCAAAGCTGCAGGCGG - Exonic
1091817031 12:3446439-3446461 TGAGGGAGCGCAGCTGCAGCTGG - Intronic
1092003480 12:5049814-5049836 TAGAAGAGAAAAGCTGCTGCAGG + Intergenic
1093088889 12:14899219-14899241 CAGGAGTGCAAAGCTGCAGTGGG - Intronic
1093281751 12:17203989-17204011 GAGGGGACCAAAGCAGCAGGGGG - Intergenic
1094554519 12:31485041-31485063 TAGTGGATCAAACCAGCAGCAGG - Intronic
1096782289 12:53998309-53998331 TAGGGGGAGACAGCTGCAGCTGG - Intronic
1097715987 12:62966710-62966732 TAGGGGAACAACACAGCAGCAGG + Intergenic
1098143800 12:67477795-67477817 TATGGGAGCAATGTTGCAGTTGG + Intergenic
1098788624 12:74791494-74791516 CATGGGAGCAGGGCTGCAGCAGG + Intergenic
1099038115 12:77615514-77615536 TACAGGAGCAAGGATGCAGCTGG - Intergenic
1099269560 12:80490546-80490568 TTGGAGAGCAAAACTGCCGCTGG - Intronic
1101778492 12:107815154-107815176 TGGGGCAGCAGTGCTGCAGCTGG - Intergenic
1102605533 12:114064752-114064774 TAGGGGAACAACACAGCAGCAGG + Intergenic
1102644399 12:114394647-114394669 CAGAGGAGCAAAGTTCCAGCAGG + Intronic
1105272766 13:18893662-18893684 TAGGGGTTCAAAGCTGAAGGTGG + Intergenic
1105309418 13:19192924-19192946 CAGGAGCTCAAAGCTGCAGCAGG + Intergenic
1106054747 13:26227783-26227805 TGGGGCAGCAGTGCTGCAGCAGG + Intergenic
1106865370 13:33958796-33958818 TAGGGCAGCCAAGATGCAGAGGG - Intronic
1106989667 13:35403313-35403335 TAGGGTTGCAAAGCTGCATGAGG + Intronic
1107779325 13:43880350-43880372 GAGGTGAGCAAAGCTGCACGGGG + Intronic
1108346782 13:49554133-49554155 TAGCAGAGAAAAGCTGCAGTAGG + Intronic
1108375254 13:49808313-49808335 TCGGGGACCAAGGCTGCAGGAGG + Intergenic
1110209398 13:72954073-72954095 GAGGGGAGCAGAGCTGCCTCTGG + Intronic
1110938292 13:81319144-81319166 TAGCAGAGAAAAGCAGCAGCTGG + Intergenic
1112286299 13:98107411-98107433 TAGGTGAGCTGAGGTGCAGCTGG - Intergenic
1113219573 13:108084680-108084702 TAGGGGAACTACACTGCAGCAGG + Intergenic
1114453275 14:22839856-22839878 TAAGAAAGCAAAGCTGGAGCAGG + Intronic
1116600454 14:46915729-46915751 TAAGGAAGCAAAGCGGCAGGAGG + Intronic
1117179866 14:53180989-53181011 TAGGGAAAGAAAGCTGCAGGGGG - Intergenic
1118821268 14:69347647-69347669 TGGGGGAGCTTAGCTGGAGCTGG - Intronic
1119482749 14:74969166-74969188 TAGGGGAGCAGAACCTCAGCTGG + Intergenic
1119551789 14:75520075-75520097 TAGGGGAGCAAAGTGGAAGCAGG - Intergenic
1119670350 14:76513685-76513707 CAGTGGAGCAAAGCTGGGGCCGG - Intergenic
1120964499 14:90155503-90155525 TAGGGAAGGATAGCTGCAGAGGG + Intronic
1122919686 14:104874884-104874906 CAGGGCAGGGAAGCTGCAGCTGG - Intronic
1123045602 14:105512149-105512171 GAGGGAGGGAAAGCTGCAGCTGG - Intergenic
1124439285 15:29675046-29675068 GAGGGGCCCAGAGCTGCAGCAGG - Intergenic
1125874408 15:43131543-43131565 TGGGAGAACAAAGCAGCAGCGGG + Intronic
1127854194 15:62941397-62941419 TAGAGGAGCTGAGATGCAGCTGG - Intergenic
1128217176 15:65942647-65942669 CGGGGAATCAAAGCTGCAGCAGG - Intronic
1128394620 15:67211377-67211399 CAGGGGACCAAAGTTTCAGCAGG + Intronic
1128602354 15:69007926-69007948 TAGGGGAACAACACAGCAGCAGG + Intronic
1131119626 15:89814424-89814446 GAGCGGAGCTAAGCTGCGGCGGG - Intronic
1132869098 16:2107718-2107740 GAAGGAAGCAAAGCTGAAGCAGG + Intronic
1132886339 16:2183884-2183906 TGGGGGCGTAGAGCTGCAGCTGG + Exonic
1134393075 16:13837773-13837795 TAGGGGAACAAATATGCACCGGG + Intergenic
1134550152 16:15135115-15135137 GAAGGAAGCAAAGCTGAAGCAGG + Intronic
1134718317 16:16367880-16367902 GAAGGAAGCAAAGCTGAAGCAGG - Intergenic
1134956435 16:18384279-18384301 GAAGGAAGCAAAGCTGAAGCAGG + Intergenic
1135110525 16:19687346-19687368 CAGGGCAGCAAAACTGCAGCTGG - Intronic
1136024286 16:27460031-27460053 TAGGTGAGAGAAGCTGCAGGTGG + Intronic
1136148480 16:28330403-28330425 TAGGGGCACACAGCTGCCGCTGG - Intergenic
1138213227 16:55180466-55180488 TAGGGGAGAAAACCTGGGGCAGG - Intergenic
1140079762 16:71734680-71734702 TAGGAGACAAGAGCTGCAGCTGG + Exonic
1140478449 16:75250473-75250495 AAGGTGACCAAAGCTGCGGCGGG + Intronic
1140832026 16:78760691-78760713 TCCGGGAGCAAAGCTGCTGTGGG + Intronic
1141437952 16:84011502-84011524 TAGGGGAACAGACCTACAGCTGG + Intronic
1142118899 16:88376389-88376411 AGGGGGAGGGAAGCTGCAGCAGG + Intergenic
1142932425 17:3298422-3298444 TCGGGGAGCAACGCTGAACCAGG - Intergenic
1143476719 17:7207408-7207430 GAGTGGAGCAAAGCTGGGGCAGG + Intronic
1143512421 17:7404053-7404075 AAGCGGCGGAAAGCTGCAGCTGG + Exonic
1143795779 17:9335182-9335204 TAGGGGAACAACACAGCAGCAGG + Intronic
1144454987 17:15411596-15411618 TAGGGCAGAAGAGGTGCAGCTGG + Intergenic
1148150400 17:45393655-45393677 TGGGGTAGCCAAGCGGCAGCTGG + Intergenic
1150891403 17:69154496-69154518 CAGGAGATCAAGGCTGCAGCAGG - Intronic
1151450623 17:74196392-74196414 TAAGGGAACAAAGCAGCACCTGG + Intergenic
1153522903 18:5968886-5968908 TAGATGAGCAAACCTGCAGCAGG + Intronic
1153667814 18:7382070-7382092 AAGGGGAGCCCTGCTGCAGCGGG - Intergenic
1153826179 18:8877014-8877036 TAGGGGAACAATACAGCAGCAGG - Intergenic
1153972554 18:10239624-10239646 CAGGGGACTAAAGTTGCAGCAGG - Intergenic
1154464550 18:14631241-14631263 TAGGGGCTCAAAGCTGAAGGTGG + Intergenic
1156186652 18:34671084-34671106 TAGGTAAACAAAGCTGCAGCTGG - Intronic
1156585179 18:38424044-38424066 AAGGGGAGCAAAGATGGACCAGG - Intergenic
1158118856 18:54026170-54026192 TGGGGGAGGAAAGGGGCAGCAGG + Intergenic
1160158357 18:76451136-76451158 GAGGGAAGCAAAGCTGAAGTGGG + Intronic
1160590167 18:79940076-79940098 TAGAGGAGCACAGATGGAGCTGG + Intronic
1163435461 19:17292615-17292637 TTGGTGAGCACAGCCGCAGCAGG - Exonic
1163723028 19:18907220-18907242 TGGGGGTGCAGAGCAGCAGCAGG + Intronic
1164655411 19:29917600-29917622 TAGGGGAACAACACAGCAGCAGG + Intergenic
1165721064 19:38080166-38080188 TTGGGGAGGAAAGCTGCAGAAGG - Intronic
1165884621 19:39069092-39069114 GAGGGGAGGAAAGGTGCAGCAGG - Intergenic
1166182088 19:41116314-41116336 CTTGGGAGCAAAGCAGCAGCAGG - Exonic
1166864070 19:45825680-45825702 GAGGGCAGCAGAGCAGCAGCGGG - Intronic
926108273 2:10166013-10166035 GAGGGGAGCACAGCAGCTGCTGG + Intronic
926426261 2:12741009-12741031 TAGGGAAGACAAGCTCCAGCGGG - Exonic
926538516 2:14144791-14144813 TTGGGAAGCACAGCTGCAGTAGG - Intergenic
928438565 2:31272482-31272504 GAGGGGACCTAGGCTGCAGCAGG + Intergenic
930735766 2:54777072-54777094 GTGGACAGCAAAGCTGCAGCTGG - Intronic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
934871698 2:97872430-97872452 TTGGGGAGCAAGGCTGGAGTGGG - Intronic
937346687 2:121130416-121130438 CAGGGGAGCAAGGCTGAGGCAGG - Intergenic
938073596 2:128320535-128320557 TAGGGGAGCACAGCTGCCCCGGG + Intergenic
939536123 2:143431391-143431413 TAGTGGAGGAAAGCTGCATTTGG + Intronic
940277186 2:151951630-151951652 GATGGGAGCTAAGCTGCAGTGGG - Intronic
940897705 2:159096590-159096612 TAGGGGAACAACACAGCAGCAGG - Intronic
941021121 2:160408201-160408223 CCGGGGTGCAAAGCTGCCGCTGG - Intronic
942452971 2:176120073-176120095 TGGGGGAGAAAAGCTGGAGGAGG + Intergenic
942487639 2:176456089-176456111 TCCTGGAGCAGAGCTGCAGCTGG - Intergenic
942911529 2:181250452-181250474 TTGGGGGGCAGAGCTGGAGCTGG - Intergenic
943523749 2:188990304-188990326 TAGGGTATCAAAGGTCCAGCTGG + Exonic
944906201 2:204264506-204264528 GGCGGGAGCAGAGCTGCAGCCGG - Intergenic
945720491 2:213412293-213412315 TAGGGGAACAACACAGCAGCAGG + Intronic
946194414 2:218024578-218024600 TAGGGGAATGAAGCTGGAGCAGG - Intergenic
946510784 2:220353796-220353818 TAGCAGAGCAAAGAAGCAGCAGG + Intergenic
1169746351 20:8946889-8946911 CAGGGGAGGAAAGCTGCAGCAGG - Intronic
1174036604 20:47672418-47672440 TAGGGGAGCAGATGAGCAGCTGG - Intronic
1174338709 20:49882910-49882932 TAGGGCAGCCAGGCTGCTGCAGG - Intronic
1175701463 20:61140755-61140777 TAGGGGAGGAAGGCTCCAGGTGG + Intergenic
1175748920 20:61481332-61481354 TTGGGGAACAGAGTTGCAGCTGG + Intronic
1176049207 20:63107769-63107791 CAGGGGAGCAGAGCTGCTGGTGG + Intergenic
1176809989 21:13527148-13527170 TAGGGGTTCAAAGCTGAAGATGG - Intergenic
1179567596 21:42258819-42258841 TTAGGGAACAAAGCTGCTGCTGG - Intronic
1179572708 21:42287271-42287293 TAGGGGAGCGAGTCTGCAGGTGG + Intronic
1183102460 22:35592408-35592430 TTGGGCAGCAGAGCTGGAGCCGG - Intergenic
1183839570 22:40486897-40486919 TAGGGGGTCAAGGCTGCAGTGGG + Intronic
1184859880 22:47167422-47167444 TATGGGAGCAAAGAAGCTGCTGG - Intronic
949943607 3:9173179-9173201 CAGGGCAGGAAAGCTTCAGCAGG + Intronic
951772211 3:26271236-26271258 TAGGTGAGAAAGGCTGCATCTGG - Intergenic
951891025 3:27568326-27568348 TAGAGGAGGGAAGGTGCAGCAGG + Intergenic
952643826 3:35631480-35631502 TCAGGGAGCAATGCTGCTGCAGG - Intergenic
952762659 3:36928504-36928526 TATGGGAGAAAAGCAGAAGCAGG + Intronic
953972820 3:47360272-47360294 TAGGGGAACAACACAGCAGCAGG - Intergenic
955906517 3:63813614-63813636 GAAGTGAGCAAAGGTGCAGCTGG - Intergenic
956778699 3:72587635-72587657 CAGGGGAGTCAACCTGCAGCAGG - Intergenic
957231555 3:77523886-77523908 TTTGGGAGCAAAGCTGCACAAGG - Intronic
957421534 3:79977909-79977931 TATGGTAGCAAAGATGCAGCTGG - Intergenic
957421558 3:79978317-79978339 TATGGTAGCAAAGATGCACCTGG - Intergenic
961008333 3:123419808-123419830 GAGGGGAGCTGAGCAGCAGCTGG - Intronic
961491684 3:127260926-127260948 CAGGGGAGCAAAGCTGTCCCTGG + Intergenic
961670025 3:128522371-128522393 TAGGTGAGCAAAACTGCTGACGG + Intergenic
963842727 3:150124096-150124118 CAGTGGAGCAAAGCTCCTGCTGG - Intergenic
965051450 3:163654997-163655019 TAGGGGACCAAGGCAGCAGGGGG + Intergenic
965970176 3:174544947-174544969 TAGGAGATCAAGGCTGCAGTGGG - Intronic
966306533 3:178542031-178542053 TAGGGGAACAACACAGCAGCAGG + Intronic
968609600 4:1551051-1551073 TAGGGGACCAGAGGTGAAGCAGG + Intergenic
969082165 4:4627229-4627251 CAGAGGAGAAAGGCTGCAGCAGG + Intergenic
970093077 4:12431287-12431309 TAGGGGAACAACACAGCAGCAGG - Intergenic
970160100 4:13179660-13179682 TGGGGGAGCAAGGCTGCTGTTGG - Intergenic
971669863 4:29542843-29542865 TAGGGGGCCAAAGCAGCAGGGGG + Intergenic
977045565 4:92064807-92064829 GAGGAGAGCAAGGCTGGAGCCGG - Intergenic
979796969 4:124858007-124858029 GAGGGGAGGAAAGCTGGAGTGGG - Intergenic
979860035 4:125682526-125682548 TAGGGGAGCAAACAGACAGCAGG + Intergenic
981171886 4:141635248-141635270 TGGGAGAGCAAGACTGCAGCTGG - Intergenic
982552547 4:156821300-156821322 CAGGAGATCAAAGCTGCAGTGGG - Intronic
984755185 4:183319637-183319659 TAGGGGAGCGTGGCTGGAGCAGG + Exonic
984755397 4:183321845-183321867 TAGGGGAGCGTGGCTGGAGCAGG + Exonic
984916864 4:184733256-184733278 TAGGGTGGAAAAGCTGGAGCAGG - Intronic
985599168 5:816855-816877 CAGGAGAACAAAGCAGCAGCGGG + Intronic
986572102 5:9176253-9176275 TATGGGTGGAAAGCTGCAGGTGG + Intronic
992204359 5:74415959-74415981 TCTGGGGGCAAAGCTGCAGACGG + Intergenic
995128985 5:108609783-108609805 TAGGGGAACAACACAGCAGCAGG - Intergenic
995731622 5:115249437-115249459 TAGGGGAACAACACAGCAGCAGG - Intronic
999047927 5:148489726-148489748 CAGGGGAGCTGGGCTGCAGCGGG + Intronic
999308830 5:150538388-150538410 TAGGGGACAAAAGTGGCAGCAGG + Intronic
999318951 5:150601431-150601453 TGGGGGAGAAAAGATGCAGCTGG + Intronic
1000306115 5:159996113-159996135 CAGTGGACCAAAGCTGCAGCTGG + Intergenic
1000978297 5:167788979-167789001 TAGTGGGGTAGAGCTGCAGCAGG - Intronic
1001329544 5:170752555-170752577 CAGGGCAGCACTGCTGCAGCGGG - Intergenic
1001558235 5:172650785-172650807 TAGGGGAACAACACAGCAGCAGG - Intronic
1002597226 5:180332134-180332156 GAGGTGGGAAAAGCTGCAGCTGG - Intronic
1002707315 5:181170483-181170505 TAGGAGAGAAAAGCTGCTGTCGG - Intergenic
1003507220 6:6750039-6750061 TAGAGCTGAAAAGCTGCAGCTGG - Intergenic
1003951647 6:11121846-11121868 GAGTGGAGCAATGCTGCAGGAGG - Intronic
1006326217 6:33355948-33355970 TAGGGGAACGAAACAGCAGCAGG - Intergenic
1009462596 6:63932586-63932608 TAGGAAAGCAAAGCAGCAGTGGG - Intronic
1010611410 6:77957979-77958001 TAGGGGTCCAGAGCTGAAGCAGG + Intergenic
1012422873 6:99084136-99084158 AAGGGGAGGAAGCCTGCAGCGGG + Intergenic
1014110590 6:117616242-117616264 TAGGGAAAGAAAGCCGCAGCAGG + Intergenic
1016313867 6:142764432-142764454 TAGAGAAGCAAGGCAGCAGCTGG - Intronic
1016997539 6:149970849-149970871 CAGGGGAGCTGAGCTGCTGCTGG + Intronic
1017001261 6:149999327-149999349 CAGGGGAGCTAAGCTGCTGTTGG - Intergenic
1017702529 6:157089342-157089364 TAGGAGGGCAAATCTGCAGTGGG - Intronic
1018883087 6:167904654-167904676 TATTGGAGCAACGCTGCAGATGG - Intronic
1020484589 7:8705616-8705638 TATGGGACCACAGCTGCAACTGG - Intronic
1021418739 7:20420778-20420800 TAGGGGATCAAAGCTTCGGTGGG + Intergenic
1021907822 7:25353058-25353080 TGGGGGTGCCAAGCAGCAGCAGG + Intergenic
1022013464 7:26329030-26329052 TAGGGGGCCAAAGCAGAAGCAGG - Intronic
1022237165 7:28473246-28473268 TAGGGGATCAAGGGTGTAGCGGG + Intronic
1022782580 7:33601331-33601353 AGGGGAAGAAAAGCTGCAGCTGG - Intronic
1023436802 7:40147999-40148021 TAGGGGAACAACACAGCAGCAGG - Intronic
1025144311 7:56491627-56491649 GTGGGGACCAGAGCTGCAGCAGG - Intergenic
1026990073 7:74580027-74580049 GAGGAGGGCCAAGCTGCAGCGGG - Intronic
1028821824 7:95220504-95220526 TAGTGAAACACAGCTGCAGCTGG - Intronic
1030871285 7:114759315-114759337 TAGGGGAGCCAAGAGGAAGCAGG - Intergenic
1034440922 7:151085871-151085893 TAGGAGAGCACTGCTGCAGCCGG + Intronic
1039052454 8:33507299-33507321 TACTGGAGCAAATCAGCAGCTGG + Exonic
1040626116 8:49151634-49151656 TATGGGCCCACAGCTGCAGCAGG + Intergenic
1042222046 8:66483635-66483657 AAGGGCAGCAAGGCTGAAGCAGG - Intronic
1042513638 8:69636894-69636916 TAGTGGATCAAACCAGCAGCAGG + Intronic
1042772722 8:72396844-72396866 CAGGGGAGCAAAGCTCCTCCTGG + Intergenic
1048868825 8:138780729-138780751 CCGGGGGGCAAAGCTGCTGCTGG + Intronic
1050568386 9:6911925-6911947 TAGGGGAGCAACCCTGCAGAAGG - Intronic
1051273729 9:15379439-15379461 TAGGGGAACAACACAGCAGCAGG - Intergenic
1051853241 9:21533426-21533448 AAGGGGAGCACAACTGGAGCAGG - Intergenic
1052403870 9:28034188-28034210 CTGGGGAGCAGAGCAGCAGCTGG - Intronic
1053110489 9:35455597-35455619 TAGGGGAACAACACAGCAGCAGG - Intergenic
1053351187 9:37414405-37414427 GTGGGGTGCAAGGCTGCAGCAGG + Intergenic
1054761567 9:69009470-69009492 TCTTGGAGCAGAGCTGCAGCTGG - Intergenic
1057236582 9:93366251-93366273 TGGGGAAGTGAAGCTGCAGCAGG + Intergenic
1057822061 9:98340100-98340122 TGGTGGGGGAAAGCTGCAGCTGG + Intronic
1059326796 9:113508589-113508611 TAGGAGGGCACAGCAGCAGCAGG - Intronic
1059450473 9:114368411-114368433 TCCGGGAGAAGAGCTGCAGCTGG - Intronic
1060618732 9:125043940-125043962 CATGGGTCCAAAGCTGCAGCTGG - Intronic
1061036045 9:128114903-128114925 CAGGGGAGTGAAGCTGCGGCGGG + Intergenic
1061367053 9:130177549-130177571 CAGTGGAGCAGAGCAGCAGCAGG + Intronic
1062046399 9:134426472-134426494 CAGGGGAGCTGAGATGCAGCCGG + Intronic
1062186359 9:135220657-135220679 GTGGGGAGCAAATCCGCAGCTGG + Intergenic
1062566870 9:137167491-137167513 GACGGGAACACAGCTGCAGCTGG - Intronic
1189349649 X:40267050-40267072 TTGGGGAGCTGAGCTGCTGCAGG + Intergenic
1190789646 X:53686683-53686705 GAGGGGAGCAGGGCTGGAGCAGG - Intronic
1198313056 X:135438635-135438657 GAAGGGACCAAAGTTGCAGCAGG + Intergenic
1198399604 X:136256360-136256382 TGGGGGAGCAGTGCTGCAGTGGG - Intronic
1198742681 X:139857631-139857653 TAGGGGAACAACGCAGCAGCAGG + Intronic
1198965590 X:142226451-142226473 TAGGGGAACAACACAGCAGCAGG - Intergenic
1200736243 Y:6799289-6799311 TAGGAGATCAAGGCTGCAGTGGG - Intergenic
1200769494 Y:7110413-7110435 TAGGGGAACAACACAGCAGCAGG + Intergenic