ID: 1063430954

View in Genome Browser
Species Human (GRCh38)
Location 10:5987871-5987893
Sequence CAGAGTGGGGAGAAGGCGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063430945_1063430954 -2 Left 1063430945 10:5987850-5987872 CCATCTGTCCAGGCAGAACGCCA No data
Right 1063430954 10:5987871-5987893 CAGAGTGGGGAGAAGGCGGGTGG No data
1063430948_1063430954 -10 Left 1063430948 10:5987858-5987880 CCAGGCAGAACGCCAGAGTGGGG No data
Right 1063430954 10:5987871-5987893 CAGAGTGGGGAGAAGGCGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063430954 Original CRISPR CAGAGTGGGGAGAAGGCGGG TGG Intergenic
No off target data available for this crispr