ID: 1063431638

View in Genome Browser
Species Human (GRCh38)
Location 10:5995892-5995914
Sequence ATCTGTTGCCAGGAGTAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063431638_1063431643 19 Left 1063431638 10:5995892-5995914 CCATTTTACTCCTGGCAACAGAT No data
Right 1063431643 10:5995934-5995956 CCAGGATCCTCAACATCAGTAGG No data
1063431638_1063431641 1 Left 1063431638 10:5995892-5995914 CCATTTTACTCCTGGCAACAGAT No data
Right 1063431641 10:5995916-5995938 TAGAAGGATCATAGAGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063431638 Original CRISPR ATCTGTTGCCAGGAGTAAAA TGG (reversed) Intergenic
No off target data available for this crispr