ID: 1063437592

View in Genome Browser
Species Human (GRCh38)
Location 10:6047107-6047129
Sequence TGCAGGGATTTGAGGGTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 249}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063437592_1063437599 4 Left 1063437592 10:6047107-6047129 CCAAGGACCCTCAAATCCCTGCA 0: 1
1: 0
2: 2
3: 24
4: 249
Right 1063437599 10:6047134-6047156 CTGCGCATGCCCTAACCCTGAGG No data
1063437592_1063437600 7 Left 1063437592 10:6047107-6047129 CCAAGGACCCTCAAATCCCTGCA 0: 1
1: 0
2: 2
3: 24
4: 249
Right 1063437600 10:6047137-6047159 CGCATGCCCTAACCCTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063437592 Original CRISPR TGCAGGGATTTGAGGGTCCT TGG (reversed) Intronic
903373214 1:22850210-22850232 TGCTGGGATTTGGGGAGCCTGGG - Intronic
904602817 1:31683230-31683252 TGCAGGGACTTCCGGGACCTCGG - Exonic
905605486 1:39295301-39295323 TGCAGGCTTTTGAGGGACATAGG - Intronic
906325506 1:44843108-44843130 TGCAGGGAGCTGCGGGTCCGGGG + Intergenic
907524487 1:55046308-55046330 TGCAGGGATATGGGAGTGCTGGG + Intronic
908170263 1:61497444-61497466 AGCAGGAATTTCAGGGTGCTTGG + Intergenic
908401345 1:63774784-63774806 TGGAGGGGTTTGAGGGTCCTGGG + Intronic
911655090 1:100434873-100434895 TAGAGAGATTTGAGGGTCATTGG + Intronic
912582182 1:110730514-110730536 TGCAGGGAGTTGATGCTCCTGGG + Intergenic
912804086 1:112742278-112742300 TCCAGGGATTTGGGGGCCTTTGG + Intergenic
913346697 1:117817181-117817203 TGGAGGGCTTGGAGGGTCCATGG + Intergenic
913394909 1:118356664-118356686 TTCAGGGATTTAAACGTCCTTGG - Intergenic
914247535 1:145897180-145897202 GGCTGGGATCTGAGGGTCCTGGG - Intronic
916869360 1:168895757-168895779 TCCAGGGATTTCAGTGTCCTGGG + Intergenic
917045308 1:170853073-170853095 TGTAGGGATTTGGGATTCCTAGG - Intergenic
918004516 1:180529222-180529244 TGCAGGGAGCTGGGTGTCCTTGG + Intergenic
918068501 1:181118129-181118151 TTCAGAGATTTGGGGGACCTAGG - Intergenic
918915626 1:190633621-190633643 TGCAGGTATTTGAAGGGACTTGG + Intergenic
919935584 1:202248566-202248588 TGGAGGACTTTGAGGGTCCTGGG + Intronic
921871996 1:220151380-220151402 TTCAGTGTTTTGAAGGTCCTGGG + Exonic
923486295 1:234434686-234434708 GACAGAGATTTGAGGGTCCCTGG + Intronic
1063124888 10:3129053-3129075 TGAACGGATTGGAGGGTCCCGGG + Intronic
1063346638 10:5318159-5318181 TCCAGGGATGTGAGGGACCAAGG - Intergenic
1063437592 10:6047107-6047129 TGCAGGGATTTGAGGGTCCTTGG - Intronic
1063574057 10:7245140-7245162 GGCAGGGATGTTGGGGTCCTGGG - Intronic
1068742124 10:60485486-60485508 TGCAGGGATTATGGGGTTCTAGG + Intronic
1068787333 10:60990634-60990656 TGCAGGGATTCCTGGGTCATGGG - Intronic
1070681951 10:78454858-78454880 TGGAGGCATTTGAGGGTAGTGGG + Intergenic
1071447315 10:85760803-85760825 TGCAGCAATTTGAGGTTCCCTGG + Intronic
1073123289 10:101134696-101134718 TCCAGGGATCTGTGAGTCCTGGG + Intronic
1074263340 10:111875814-111875836 TGCAGGGATCTGGGGGACTTTGG + Intergenic
1074650802 10:115522576-115522598 ACCAGGGATTTGAGGGGCCAGGG - Intronic
1074895168 10:117771045-117771067 TGCATGGTTTTGAGGGTCTCAGG - Intergenic
1075220322 10:120579132-120579154 TGCAGGGACTTGAGGGGTCAGGG - Intronic
1077960090 11:7066803-7066825 TGCAGGGTTTTGATGGTTTTAGG + Intronic
1078724431 11:13916879-13916901 TGAAGGGAATTGAGGGTTCCAGG + Intergenic
1078992779 11:16666044-16666066 TGCAGGTATTTGAAGGGACTTGG - Intronic
1079050244 11:17149421-17149443 ATCAGGGATTTGAGCATCCTGGG + Intronic
1083369465 11:62166799-62166821 TGCAGGGAATTGAAGTTCATGGG + Intergenic
1084950425 11:72662318-72662340 TGCTGGGAGTTGAGGGACCTTGG - Intronic
1085026342 11:73238802-73238824 TGCAGGGCTGTGAGTGTCGTGGG - Intergenic
1085218329 11:74851488-74851510 TGGAGGCATTTTAGAGTCCTGGG - Intronic
1085302009 11:75464196-75464218 GACAGGGATCTGAGGTTCCTGGG - Intronic
1085336180 11:75698234-75698256 TGCAGGGCCTTGAAGGCCCTGGG - Intergenic
1087129115 11:94653605-94653627 TGCAGGGTTTTAAGAGTCCATGG - Intergenic
1089383717 11:118054132-118054154 TGCAGGGTTTTGGGGGTTTTTGG + Intergenic
1089755119 11:120680860-120680882 TACAGGGAGAAGAGGGTCCTTGG - Intronic
1090669976 11:128939267-128939289 TGCTGGGATTTGGGAGTCCAGGG - Intronic
1092262382 12:6959604-6959626 TGGTGGGATTTGGGGGTCCCAGG + Intronic
1094837061 12:34327043-34327065 AGCAGGGATGTGAGGTTCCCTGG + Intergenic
1095374966 12:41515907-41515929 TGCCTGGCATTGAGGGTCCTTGG + Intronic
1096965475 12:55623616-55623638 TGTAGGGACTTGAGCATCCTTGG - Intergenic
1096994130 12:55828554-55828576 TGAAGGTATTTCAGGGTCCACGG + Exonic
1100001639 12:89843894-89843916 TGAAAGGGTTTGAGGGTCCCAGG + Intergenic
1101037770 12:100721931-100721953 AGCAGGGATTTGAGAGGCCAAGG - Intronic
1101598999 12:106192313-106192335 TGAAGGGAGTTGAGGGGCTTGGG + Intergenic
1101674201 12:106903009-106903031 TGCAGTGGTTTTAGGGTGCTGGG - Intergenic
1103139501 12:118536228-118536250 TGCAGAGGCTTGAGGGTCATGGG + Intergenic
1106947305 13:34842817-34842839 AGGAGGGATTTGAGGGTACAGGG + Intergenic
1107010574 13:35666121-35666143 TGAAGGGATGGGAGGGGCCTGGG + Intronic
1111957647 13:94775983-94776005 TCCAGGGATATTAGGATCCTGGG + Intergenic
1113452813 13:110423767-110423789 TCCATGGATTTGAGCGTGCTAGG + Intronic
1113727637 13:112617070-112617092 AGCAGGGATTTCCAGGTCCTAGG - Intergenic
1114209819 14:20605136-20605158 TGCGGGGCTTGGAGGGTCCATGG - Intronic
1116540981 14:46101182-46101204 TGCATGGCTCGGAGGGTCCTAGG - Intergenic
1118923399 14:70170197-70170219 TGCAAGGCTTTGAAGGTCATGGG - Intronic
1119738831 14:77000755-77000777 TGCAGGGATAGGAGGGGCCCGGG - Intergenic
1119739582 14:77005480-77005502 TGCAGGTTATTGAGGGTCCTAGG - Intergenic
1121250398 14:92495508-92495530 TGCAGGGATTCCAGAGCCCTCGG + Exonic
1124721874 15:32117569-32117591 TCCTAGGACTTGAGGGTCCTAGG + Intronic
1124939167 15:34202025-34202047 ATCAGGGATTTGAGCATCCTCGG + Intronic
1125166012 15:36705497-36705519 TGCAGTGATTTGAGAGGTCTAGG + Intronic
1126828720 15:52577340-52577362 TGCTGGGATTACAGGGTGCTCGG + Intergenic
1128558928 15:68651763-68651785 GGCAGGGATTTGGGGATCCTGGG - Intronic
1128745391 15:70110783-70110805 TGCTAGGATGTGAGGGTCCCGGG + Intergenic
1128875825 15:71200428-71200450 TTCAGGCATTTCAGGGTCCTCGG - Intronic
1129666093 15:77580149-77580171 AGCAGGGACTTGGGGGTGCTAGG - Intergenic
1130933771 15:88451374-88451396 TGCAGGTAGTCGAGGCTCCTGGG - Intergenic
1131440377 15:92455068-92455090 TGCAGAGACTTGAGGGCCCAAGG + Intronic
1131958181 15:97760302-97760324 TGAAGGGAATTAAGAGTCCTGGG - Intergenic
1132372288 15:101307389-101307411 TGCAGGGAGGTGAGGGTTCTGGG - Intronic
1133703645 16:8332795-8332817 TGGAGGGAGATGAGGGTGCTTGG - Intergenic
1138782680 16:59808128-59808150 TGCAGGGATGTTGGGGTCTTTGG - Intergenic
1139515226 16:67448873-67448895 TGCTGTGGTTTCAGGGTCCTGGG - Intronic
1140700923 16:77580939-77580961 TCCAGAGATTTGTGTGTCCTGGG - Intergenic
1140726404 16:77816989-77817011 TGCCAGGATTTGAGTGTTCTGGG + Exonic
1140816695 16:78627793-78627815 TGCAGTGATTTCAGGGTGTTGGG + Intronic
1142761281 17:2043172-2043194 AGCAGTGAGTGGAGGGTCCTGGG - Exonic
1143523892 17:7461811-7461833 TGCAGGGACTTGGGGGCCCCTGG - Exonic
1143532386 17:7512889-7512911 TGTAGGGGCTTGAGGGACCTGGG - Exonic
1144855547 17:18265422-18265444 TTCAGGCAGCTGAGGGTCCTGGG + Exonic
1145005051 17:19332909-19332931 TGTAGGGATCTGAGGATCTTGGG + Intronic
1145266373 17:21381421-21381443 TGCAGGGCCCTGAGGGTCCCAGG - Intronic
1147218949 17:38917043-38917065 TGCAGGGACTTGTGGGCCCCAGG + Intronic
1147740707 17:42669757-42669779 TCCAGGGATGTGAGGGCCCAAGG + Intronic
1150292124 17:63988114-63988136 TGCTGGGATTTTAGGGGGCTTGG - Intergenic
1150567771 17:66357123-66357145 TGCTGGGAAATGAGGGTCCCAGG + Intronic
1150642626 17:66959922-66959944 TGAGGGGATTTGAGGAGCCTGGG - Intergenic
1151222893 17:72626526-72626548 TACAGGGATTTGTTGGGCCTGGG + Intergenic
1151836797 17:76587108-76587130 TGCAAGGATGAGAGGGACCTAGG + Intergenic
1152439128 17:80294668-80294690 TCCAGGGTTTTGATGGTCTTAGG + Intronic
1157269589 18:46261833-46261855 TGCAGGAGTTTAAGGGTCCTTGG + Intronic
1157300119 18:46473198-46473220 TGCAGGGGTTTTTGGGCCCTGGG - Intergenic
1159483529 18:69022957-69022979 AGCACGGATTTTAGGATCCTTGG - Intronic
1160482365 18:79253466-79253488 TACAAGGATTTGTGGGTCCATGG + Exonic
1160722735 19:604517-604539 GGCAGGGCTGTGAGGGTGCTGGG + Intronic
1160778643 19:868129-868151 TCCAGGGATCTGGGGGTCCTGGG + Exonic
1160799186 19:959958-959980 GGCAGCGGCTTGAGGGTCCTAGG + Intronic
1160930829 19:1568705-1568727 TGCAGGGAGGTGGGGGTCCCTGG - Intergenic
1161896854 19:7088986-7089008 TTCAGGGATTAGAGGGTAATCGG + Intergenic
1162340962 19:10091444-10091466 GGCAGGGCTGTGAGGGTCCGAGG - Intronic
1162751130 19:12830129-12830151 TCCTGGGATTTGAACGTCCTTGG - Intronic
1163714966 19:18868249-18868271 TGCAGGGGGTGGAGGGTGCTGGG + Intergenic
1163969784 19:20780998-20781020 TGCAGAGACTTGTGGGTTCTTGG - Intronic
1164544208 19:29145581-29145603 TGCGGGGACTTGTGTGTCCTTGG - Intergenic
1165649514 19:37473423-37473445 TGCTGGGAAGTGAGGGTACTCGG + Intronic
1165833470 19:38741048-38741070 GGCAAAGATTTGAGGGTCCCAGG + Intronic
1166044830 19:40223690-40223712 AGCACGGGCTTGAGGGTCCTGGG + Intronic
1166420194 19:42630690-42630712 AGTGGGGATTTGGGGGTCCTGGG - Intronic
1166658659 19:44630530-44630552 GGCAGGGACTTGAGGTGCCTGGG - Intronic
1166810503 19:45511524-45511546 TGCAGGGAGGAGTGGGTCCTGGG + Intronic
1167253620 19:48414676-48414698 TGGAGGGCTTTGTGGGTCCTGGG - Intronic
925919166 2:8627519-8627541 GGCAGGGTTCTGAGGGTCCCCGG - Intergenic
926197856 2:10774543-10774565 TGCAGGGAGTGTAGGGGCCTGGG - Intronic
927061917 2:19431401-19431423 TGCAGGGCTTTGTGGATGCTGGG + Intergenic
927732554 2:25487473-25487495 TTCAGGGACTTGAGCATCCTTGG + Intronic
927989335 2:27436390-27436412 AGCAGGGATTAGAGGTACCTGGG + Intronic
928651085 2:33404627-33404649 TACAGGAATGTGAGGGTCCTCGG + Intergenic
929407725 2:41661798-41661820 TGAATGGATTTGAGGAACCTAGG + Intergenic
929924328 2:46196380-46196402 TGCTGGGGGTTGGGGGTCCTAGG + Intergenic
930048311 2:47193240-47193262 GGCTGGGATTTGAGGGCCCCAGG + Intergenic
930934629 2:56932984-56933006 TGTAGGGATTTGTGGGACATAGG - Intergenic
931155593 2:59625089-59625111 GCCACGGATTTGAGGGTCCCGGG + Intergenic
931622803 2:64228301-64228323 TGAAGGGATTTGAGGGGCGAAGG - Intergenic
933697724 2:85232447-85232469 AGCAGTGATATGAGTGTCCTGGG + Intronic
935050870 2:99523995-99524017 TCCAGAGGTTTGATGGTCCTTGG + Intergenic
936264507 2:110992526-110992548 TGGAGGGATTTAAGGGTACCAGG - Intronic
937429775 2:121828534-121828556 GGCAGGGATATGAGGCTTCTCGG + Intergenic
937547174 2:123036505-123036527 TGCACAGACTTGAGGGCCCTGGG + Intergenic
937834611 2:126459701-126459723 TGCAGGGAATGCAGTGTCCTTGG + Intergenic
938032497 2:128007395-128007417 TGAAGGAACTTGAGCGTCCTTGG + Intronic
940269389 2:151874848-151874870 TGCAGGTATTTAAAGGTCCCAGG - Intronic
943772374 2:191732488-191732510 TTCATGGATTTGAGAGGCCTGGG + Intergenic
943980184 2:194539639-194539661 AGCAGGAATGTGAGGCTCCTGGG - Intergenic
947627318 2:231628109-231628131 TGCAGGGCTCAGAAGGTCCTGGG + Intergenic
947986440 2:234451677-234451699 TGCATGGATTTGGGTGTCCTTGG + Intergenic
948139054 2:235659637-235659659 TGCAGGGATCTGACAGCCCTCGG - Intronic
948930264 2:241127376-241127398 GGCAGTGATTTGCTGGTCCTTGG + Exonic
1173016996 20:39234759-39234781 TTCAGGGTTCTGAGGGTCATGGG + Intergenic
1174425238 20:50427554-50427576 TGAAGGGGGATGAGGGTCCTTGG - Intergenic
1175074168 20:56359329-56359351 TGCAGGGATTTGGGGTTTCGGGG - Intronic
1175141067 20:56860403-56860425 TGCATGTATTTGGGGGTTCTGGG - Intergenic
1178419052 21:32428950-32428972 TGCAGGGCATTCAGGGTCCAAGG + Intronic
1178934837 21:36852424-36852446 TGCATGGACTTGAGGGCCCCTGG - Intronic
1178950693 21:36983094-36983116 TGCAGTGATATGAGAATCCTGGG + Intronic
1179577489 21:42317115-42317137 TGGATGGATTTGAGGGCCCCTGG + Intergenic
1181953856 22:26574081-26574103 TGCAGGGCTTTGGGGGACCTGGG + Intronic
1183306863 22:37087361-37087383 TGGAGGGATTTCAGGCACCTTGG + Intronic
1183719132 22:39552146-39552168 GGCAGGAACTTGAGGTTCCTGGG + Intergenic
1184673711 22:46028834-46028856 TACAGGAAGTTGTGGGTCCTTGG - Intergenic
950359999 3:12443443-12443465 GGCTGGGATATGAGGGTGCTGGG + Intergenic
950494302 3:13324460-13324482 TGCAGGGAGGTGAGGAGCCTGGG - Intronic
952278091 3:31896863-31896885 GGCAGGGAGTTAAGGGTCCCTGG + Intronic
954103463 3:48396121-48396143 TGTAGGGGTTTGAGGGATCTGGG - Intronic
954146853 3:48638793-48638815 AGCAGGGGTTTGGGGATCCTGGG - Intronic
954170414 3:48797562-48797584 GGCAGGGATGGGAGAGTCCTGGG - Intronic
954841948 3:53519176-53519198 TGCTAGGGTTTGAGGGTCCTTGG + Intronic
954929601 3:54269619-54269641 TGCAAGGAGTGGAGGATCCTGGG + Intronic
955690191 3:61583190-61583212 TGCAGAGATTTGAGAGGCTTGGG + Intronic
956500904 3:69884027-69884049 TGCAGGGAAATGAGGTTTCTGGG - Intronic
961858650 3:129896401-129896423 TGCTGGGATTACAGGGTCCCTGG - Intergenic
962312870 3:134338356-134338378 TGCAGGGAGGTGATGGACCTGGG - Intergenic
962735118 3:138318716-138318738 TGCATGGGTTTGAGGTTCATAGG - Intronic
965272144 3:166630998-166631020 TGAAGGCAATGGAGGGTCCTTGG - Intergenic
966878193 3:184335489-184335511 TGCAGGGATCTGAGGTTTCCTGG + Intronic
966983465 3:185158859-185158881 TGGAGGCATTTGAAGGTGCTGGG - Intergenic
968450702 4:674742-674764 GGCAGGGACCTGGGGGTCCTGGG + Intronic
968941879 4:3643241-3643263 AGCAAGGATGTGGGGGTCCTGGG + Intergenic
969126427 4:4951668-4951690 TGGGGAGATTTGGGGGTCCTTGG - Intergenic
969685891 4:8674035-8674057 GTCAGGGATTTGAGCATCCTTGG + Intergenic
969685892 4:8674051-8674073 TCCTTGGATTTGAGTGTCCTTGG + Intergenic
974692959 4:65324202-65324224 TGCAGGGATTTGAGACGGCTTGG - Exonic
975132357 4:70842098-70842120 TGCTGGCATTGGTGGGTCCTGGG - Intergenic
975629220 4:76382394-76382416 TGCAAGTATTTGGGGCTCCTGGG - Intronic
979453704 4:120902883-120902905 TGAAGGGATCTTAGGGTCATGGG - Intronic
984866855 4:184288355-184288377 TGCAGGGATTTGAATGTGTTGGG + Intergenic
985538741 5:478200-478222 GGGGGGGATTTGAGGGTCATTGG + Intronic
985580823 5:694279-694301 TGCTGGGACTTGAGGGGCATAGG + Intergenic
986044857 5:4027065-4027087 TGCATGGATTGGCGGGTCCCTGG - Intergenic
988422271 5:31020836-31020858 TGCAAGTATTTCAAGGTCCTGGG - Intergenic
993795349 5:92259891-92259913 TGCAGGGTTTTGATGGTTTTAGG - Intergenic
994236171 5:97365630-97365652 AGCAGGGTTTTGAGTGTCCCTGG + Intergenic
994458223 5:100041777-100041799 AGCAGGGAGTTGAGGGTCTTAGG + Intergenic
995005806 5:107194115-107194137 TGCAGGGTTTTATGGCTCCTAGG + Intergenic
998579299 5:143354502-143354524 CTCAGGGATTTGAGAGTCCCAGG + Intronic
999142656 5:149372623-149372645 TGCAGGGGTTAGAGGGCCCAGGG + Intronic
999742738 5:154568869-154568891 TGCCAGGCTTTGAGGCTCCTCGG - Intergenic
1000041343 5:157487373-157487395 TGCAGGCTTTGGAGGGTCCTTGG - Intronic
1000220222 5:159208422-159208444 TTCACGGGTCTGAGGGTCCTTGG + Intronic
1001129207 5:169049630-169049652 TGCAGGGAGTCTAGGGCCCTAGG - Intronic
1002172728 5:177384493-177384515 GGTTGGGATGTGAGGGTCCTGGG - Intronic
1002560959 5:180081952-180081974 GGCAGGAGTTTGAGGGTCCTGGG - Intergenic
1002878615 6:1233019-1233041 TGCAGGGCGTTGATGGTTCTAGG + Intergenic
1003053148 6:2797694-2797716 TCAAGGGATTTCAGGGACCTGGG - Intergenic
1004843212 6:19610891-19610913 TGGAGCGGTGTGAGGGTCCTGGG - Intergenic
1005253929 6:23979468-23979490 TCTAGGGATTTGGGGGGCCTGGG - Intergenic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1008417641 6:51261550-51261572 TGATGGGACTTGAGTGTCCTTGG - Intergenic
1009397781 6:63220925-63220947 TTCAGGTTTGTGAGGGTCCTGGG - Intergenic
1010634701 6:78243455-78243477 TGAAGGCATTTGAGGGTCGAGGG - Intergenic
1011353638 6:86451092-86451114 TGCAGGGCTGTGAGTGCCCTTGG - Intergenic
1012152286 6:95769506-95769528 GACAGGGATTTCAGGTTCCTAGG - Intergenic
1012214475 6:96564937-96564959 TGCAGGGATTTGAGGCATGTTGG - Intronic
1012878871 6:104761577-104761599 TGCAGGATTTTTATGGTCCTAGG - Intronic
1013338026 6:109185177-109185199 AACAGGGATATGAAGGTCCTGGG - Intergenic
1017648038 6:156556864-156556886 TGGTGGGATTGGAGGGACCTGGG - Intergenic
1017881037 6:158562623-158562645 TGCTGTGGTTTCAGGGTCCTGGG + Intronic
1017950417 6:159130918-159130940 TGCAGGGAAGCGAGTGTCCTCGG - Intergenic
1018161773 6:161051675-161051697 TCCAAGGATTTGAGTGTCCATGG - Intronic
1019299656 7:296704-296726 AGCAAGGTTTTGAGGGTCTTTGG + Intergenic
1019718014 7:2550214-2550236 TGCAGCGATTTGAGAGGCCAAGG + Intronic
1020528047 7:9289472-9289494 GGCTGGGATTTGAAAGTCCTTGG + Intergenic
1023716399 7:43047972-43047994 TCCAGGTATTTGAAGGTACTTGG - Intergenic
1027186976 7:75978495-75978517 AGCAGGGACTTGAGCATCCTTGG + Intronic
1028965447 7:96796673-96796695 TGCAGGTATTTGTGGGCCCTTGG - Intergenic
1030581052 7:111356470-111356492 ATCAGGGATTTGAGCATCCTCGG + Intronic
1033446304 7:141425333-141425355 TGCAGGAATTTGGGGTTGCTTGG - Intronic
1034518277 7:151599319-151599341 TGAGTGGATTTGAGGGTTCTGGG - Intronic
1034557788 7:151860904-151860926 TACTGGGACTTTAGGGTCCTTGG - Intronic
1036220984 8:6921547-6921569 TTGAGGTATTTGAGGTTCCTTGG + Intergenic
1036647995 8:10624005-10624027 TGCAGGGATATGGAGGTGCTGGG - Intronic
1037414165 8:18630946-18630968 ATCAGGGACTTGAGTGTCCTTGG + Intronic
1038327236 8:26580280-26580302 TGCACTGATTTGAGTGACCTGGG + Intronic
1039521754 8:38177163-38177185 TGCGGGGAGGTGAGGGCCCTTGG + Intronic
1040685235 8:49863968-49863990 TTTAGTGATTTGAAGGTCCTGGG - Intergenic
1041154078 8:54965805-54965827 TGAAGGGAGTTGAAGATCCTTGG + Intergenic
1041209846 8:55538136-55538158 TGCAGGGATGGGAGGGTCTATGG + Exonic
1041418126 8:57636255-57636277 TGAAGGGATTTGAATGTCCTGGG + Intergenic
1042428320 8:68674135-68674157 TCCAGGTATTTGAGGGGACTTGG - Intronic
1045165926 8:99604754-99604776 TGCTGGGATTACAGGTTCCTTGG + Intronic
1045290331 8:100827420-100827442 TGCAAGAATTTTAGGGTTCTTGG - Intergenic
1045882772 8:107060802-107060824 TCTAGGGATTTTATGGTCCTAGG + Intergenic
1045949474 8:107835370-107835392 TTCAGGTTTTTGAGAGTCCTAGG - Intergenic
1046198276 8:110890891-110890913 TGAAGGGCTTGGAGGGTCCATGG + Intergenic
1048387991 8:133930978-133931000 TGCAGAGCCTTGAGGGTGCTTGG - Intergenic
1049358082 8:142198589-142198611 TGGAGGGGTCTGAGGGCCCTCGG - Intergenic
1049528821 8:143143078-143143100 AGCAGGGTTTTGAGGGCCCCTGG - Intergenic
1050628587 9:7535084-7535106 TGGAAGGAATTGAGGGTTCTGGG - Intergenic
1051165441 9:14257374-14257396 TGCTGGGTTTTGCTGGTCCTGGG - Intronic
1052412952 9:28146258-28146280 AGCAGGGATTTGAGGGCCCAGGG - Intronic
1052756763 9:32550426-32550448 CTCAGGGATTTAAGGGACCTAGG + Intronic
1053206416 9:36190431-36190453 TTTATGGATTTGAGGGTCCCTGG - Intergenic
1054745486 9:68850082-68850104 TGCAGGGTATTCAGGGGCCTAGG + Intronic
1058840869 9:108907879-108907901 TGCTGTGCTTTGAGGCTCCTGGG - Intronic
1059710868 9:116866515-116866537 TGAAGAGAGTTGAGGATCCTGGG + Intronic
1059769344 9:117412640-117412662 TGAAGGGATGAGACGGTCCTTGG - Intronic
1059777463 9:117489764-117489786 TGCAGGGATTGGAGAGTCCTAGG - Intergenic
1061318467 9:129812804-129812826 CACAGGGATCTGAGGATCCTAGG - Intergenic
1061793779 9:133071727-133071749 TGCAGGCATCTGAGCTTCCTTGG - Exonic
1062345816 9:136114682-136114704 TGCAGGGAGTTGTGGCACCTTGG - Exonic
1062469511 9:136696400-136696422 TGCTGGGAGGTGAGGGTCCCTGG + Intergenic
1187328291 X:18312326-18312348 ATCAGGGACTTGAGTGTCCTTGG - Intronic
1187477062 X:19620706-19620728 TGCGTGGATTTGAAGGACCTTGG - Intronic
1187693792 X:21898014-21898036 TGCAGGCCTTTGAGTCTCCTGGG - Intergenic
1189269233 X:39739201-39739223 ATCAGGTATTTGAGGCTCCTGGG - Intergenic
1189755814 X:44270366-44270388 AGCAGGGATTTGAGGGCCATGGG - Intronic
1191134498 X:57049261-57049283 TGCCTGGCTTGGAGGGTCCTAGG + Intergenic
1191609924 X:63101673-63101695 TGCTGGGATTCCAGGGGCCTAGG - Intergenic
1191655727 X:63597138-63597160 TTCAGGGATTTGAGAGTTTTTGG + Intergenic
1192802541 X:74480265-74480287 TGCATGGCTGGGAGGGTCCTAGG - Intronic
1193507483 X:82362184-82362206 TGGGGGGATTGGAGGGTCCATGG + Intergenic
1197674580 X:129315547-129315569 TGCAGGGATTTCTGGGCCTTGGG - Intergenic
1198169362 X:134090686-134090708 TCCAGGGATATGAGGGTCTGAGG - Intergenic
1200236820 X:154471797-154471819 TGCTGGAATTTGAGGGACCCAGG + Intronic
1201067567 Y:10112728-10112750 TGCCTGGATTGGAGGGTCCTAGG - Intergenic
1201492912 Y:14562180-14562202 TTCAGGAATTTTATGGTCCTAGG + Intronic