ID: 1063442455

View in Genome Browser
Species Human (GRCh38)
Location 10:6084004-6084026
Sequence CTGTTCAAAGCGTTGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063442451_1063442455 9 Left 1063442451 10:6083972-6083994 CCACATTAAGGTTGCCACTCAAA No data
Right 1063442455 10:6084004-6084026 CTGTTCAAAGCGTTGGAGCAAGG No data
1063442449_1063442455 28 Left 1063442449 10:6083953-6083975 CCTGATCACACGTTGGGGACCAC No data
Right 1063442455 10:6084004-6084026 CTGTTCAAAGCGTTGGAGCAAGG No data
1063442452_1063442455 -5 Left 1063442452 10:6083986-6084008 CCACTCAAAGCTGTACTCCTGTT No data
Right 1063442455 10:6084004-6084026 CTGTTCAAAGCGTTGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063442455 Original CRISPR CTGTTCAAAGCGTTGGAGCA AGG Intergenic
No off target data available for this crispr