ID: 1063443262

View in Genome Browser
Species Human (GRCh38)
Location 10:6089971-6089993
Sequence GGTACGTTGTTAGATGTGAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 42}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063443260_1063443262 19 Left 1063443260 10:6089929-6089951 CCTCTCTTGAGAGAGGAGGTCAT 0: 1
1: 0
2: 0
3: 13
4: 158
Right 1063443262 10:6089971-6089993 GGTACGTTGTTAGATGTGAGAGG 0: 1
1: 0
2: 0
3: 0
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063443262 Original CRISPR GGTACGTTGTTAGATGTGAG AGG Exonic
901266215 1:7912857-7912879 GGTACGTGGTTACAAGTGAATGG - Intergenic
907564622 1:55423383-55423405 GGTACTTTGTTAAATCTCAGAGG - Intergenic
924328259 1:242917458-242917480 GGTACTTTATAAAATGTGAGGGG - Intergenic
924353870 1:243148811-243148833 GTTAATTTGTTAGATGTTAGTGG + Intronic
1063443262 10:6089971-6089993 GGTACGTTGTTAGATGTGAGAGG + Exonic
1071665218 10:87548388-87548410 GTTAATTTGTTAGATGTGACAGG - Intronic
1073428977 10:103473719-103473741 GGCCCGAGGTTAGATGTGAGTGG + Intronic
1079598128 11:22278276-22278298 AGTACGTTTTTAGATCTAAGGGG - Intronic
1092107560 12:5933085-5933107 GCTACGTGGTGAGATTTGAGGGG + Intronic
1099214172 12:79834060-79834082 GGTACATTGTTAGATGCTACAGG + Intronic
1099479664 12:83149854-83149876 GATGCGTTGTTTTATGTGAGAGG - Intergenic
1111785893 13:92786382-92786404 GGTAAGTTGTTAGGTGTAATAGG + Intronic
1120800583 14:88683921-88683943 AGTACATTGTTAAATGTAAGTGG - Intronic
1121334467 14:93069050-93069072 GGTACCTGGGTAGATGTGGGAGG - Intronic
1129786606 15:78314117-78314139 GGGACATTGTTTGATGGGAGAGG - Intergenic
1134815972 16:17206273-17206295 GGTTCTTTGTTAGATCTGGGTGG + Intronic
1143738870 17:8937276-8937298 AGTACGATGTTAAATATGAGTGG + Intronic
1156449317 18:37258152-37258174 GGCATGGTGTTAGATGGGAGAGG - Intronic
1161605583 19:5213075-5213097 GGTGAGGTGTTGGATGTGAGAGG - Intronic
928399257 2:30966087-30966109 GGCACGTAGTTAGATGTGTCTGG + Intronic
928407221 2:31023933-31023955 TGTAAGTTGTTGGATATGAGAGG - Intronic
935315952 2:101834104-101834126 GGTTCATTCATAGATGTGAGTGG + Intronic
1178181020 21:30161702-30161724 GGTACGATATTAGATATGACTGG - Intergenic
1182882029 22:33741960-33741982 GGTACGTTCTCATTTGTGAGTGG - Intronic
950181133 3:10914230-10914252 GGTACCTTGCTAGATGTGGCAGG + Intronic
950787411 3:15448137-15448159 GGTATGTTGTCAGAGGTGAAGGG + Intronic
951775797 3:26309084-26309106 GGTAGGTAGTTAGACATGAGTGG + Intergenic
966987246 3:185192559-185192581 GGTACGTGGTTCAATGTGATGGG + Exonic
969231668 4:5836200-5836222 GGCACGTTTTTAGCTGGGAGAGG - Intronic
975742282 4:77441374-77441396 GGTACATGGATAGATCTGAGTGG + Intergenic
979247935 4:118530817-118530839 GTTAATTTGTTAGATGTTAGTGG - Intergenic
979399567 4:120232102-120232124 GGTAATTTCTTTGATGTGAGAGG + Intergenic
980168181 4:129253166-129253188 GGCACTTTGTGAGATGTGATTGG + Intergenic
988091623 5:26548393-26548415 GTTACATTGTTAGATATGTGGGG + Intergenic
1011925031 6:92632143-92632165 GGTAGTTGGCTAGATGTGAGAGG - Intergenic
1029888899 7:103905785-103905807 GGTAGCTTGTTAGAGGTGACTGG + Intronic
1031565299 7:123288955-123288977 CGTACTATGTTAGATGGGAGTGG + Intergenic
1035074849 7:156170448-156170470 GGGACGTTGTTTGATCTGTGTGG - Intergenic
1037209661 8:16371137-16371159 GGTACCTTTTTAGATCTGATTGG - Intronic
1041924947 8:63227282-63227304 GTTATGTTGTTGGATGTGAAAGG + Intergenic
1043579204 8:81692222-81692244 GATACTGTGTTAGATGTGATAGG + Intergenic
1046181840 8:110659608-110659630 AGTACTATGTTAGATGGGAGTGG - Intergenic
1050899614 9:10929953-10929975 GCCACTTTGTTAGATGTGATGGG - Intergenic