ID: 1063447697

View in Genome Browser
Species Human (GRCh38)
Location 10:6130027-6130049
Sequence CTGTGTGCAGAGGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063447697_1063447703 -6 Left 1063447697 10:6130027-6130049 CCCTCCTCCTCCTCTGCACACAG No data
Right 1063447703 10:6130044-6130066 ACACAGGAAACCTCATTCTGTGG No data
1063447697_1063447707 6 Left 1063447697 10:6130027-6130049 CCCTCCTCCTCCTCTGCACACAG No data
Right 1063447707 10:6130056-6130078 TCATTCTGTGGTGTGAACAGGGG No data
1063447697_1063447706 5 Left 1063447697 10:6130027-6130049 CCCTCCTCCTCCTCTGCACACAG No data
Right 1063447706 10:6130055-6130077 CTCATTCTGTGGTGTGAACAGGG No data
1063447697_1063447705 4 Left 1063447697 10:6130027-6130049 CCCTCCTCCTCCTCTGCACACAG No data
Right 1063447705 10:6130054-6130076 CCTCATTCTGTGGTGTGAACAGG No data
1063447697_1063447708 7 Left 1063447697 10:6130027-6130049 CCCTCCTCCTCCTCTGCACACAG No data
Right 1063447708 10:6130057-6130079 CATTCTGTGGTGTGAACAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063447697 Original CRISPR CTGTGTGCAGAGGAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr