ID: 1063448184

View in Genome Browser
Species Human (GRCh38)
Location 10:6133479-6133501
Sequence GTGAGGAAACAGGTGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063448177_1063448184 19 Left 1063448177 10:6133437-6133459 CCTCACATTTGGCCACTGATGAA No data
Right 1063448184 10:6133479-6133501 GTGAGGAAACAGGTGGAGGAAGG No data
1063448178_1063448184 7 Left 1063448178 10:6133449-6133471 CCACTGATGAACACTGTCTGCAT No data
Right 1063448184 10:6133479-6133501 GTGAGGAAACAGGTGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063448184 Original CRISPR GTGAGGAAACAGGTGGAGGA AGG Intergenic
No off target data available for this crispr