ID: 1063451355

View in Genome Browser
Species Human (GRCh38)
Location 10:6152401-6152423
Sequence CCATGGAGGCTCCCCAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063451349_1063451355 4 Left 1063451349 10:6152374-6152396 CCACACTGCTGTGGAGCCTCTGA No data
Right 1063451355 10:6152401-6152423 CCATGGAGGCTCCCCAAGCCAGG No data
1063451348_1063451355 8 Left 1063451348 10:6152370-6152392 CCGTCCACACTGCTGTGGAGCCT No data
Right 1063451355 10:6152401-6152423 CCATGGAGGCTCCCCAAGCCAGG No data
1063451345_1063451355 26 Left 1063451345 10:6152352-6152374 CCTTGCTGGAGGCTTTACCCGTC No data
Right 1063451355 10:6152401-6152423 CCATGGAGGCTCCCCAAGCCAGG No data
1063451347_1063451355 9 Left 1063451347 10:6152369-6152391 CCCGTCCACACTGCTGTGGAGCC No data
Right 1063451355 10:6152401-6152423 CCATGGAGGCTCCCCAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063451355 Original CRISPR CCATGGAGGCTCCCCAAGCC AGG Intronic