ID: 1063455495

View in Genome Browser
Species Human (GRCh38)
Location 10:6179612-6179634
Sequence CAGGAGGACTGCAGGCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063455484_1063455495 11 Left 1063455484 10:6179578-6179600 CCATGGGGGTCGTCGAAGGACGG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 1063455495 10:6179612-6179634 CAGGAGGACTGCAGGCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063455495 Original CRISPR CAGGAGGACTGCAGGCAAGA GGG Intronic
No off target data available for this crispr