ID: 1063456361

View in Genome Browser
Species Human (GRCh38)
Location 10:6185458-6185480
Sequence CCGTCTCCTCGCCCCCGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 119}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063456361_1063456365 -8 Left 1063456361 10:6185458-6185480 CCACTGCGGGGGCGAGGAGACGG 0: 1
1: 0
2: 1
3: 9
4: 119
Right 1063456365 10:6185473-6185495 GGAGACGGCAGAGGGACGCCAGG No data
1063456361_1063456367 4 Left 1063456361 10:6185458-6185480 CCACTGCGGGGGCGAGGAGACGG 0: 1
1: 0
2: 1
3: 9
4: 119
Right 1063456367 10:6185485-6185507 GGGACGCCAGGGTCTCCCATCGG No data
1063456361_1063456366 -7 Left 1063456361 10:6185458-6185480 CCACTGCGGGGGCGAGGAGACGG 0: 1
1: 0
2: 1
3: 9
4: 119
Right 1063456366 10:6185474-6185496 GAGACGGCAGAGGGACGCCAGGG No data
1063456361_1063456369 15 Left 1063456361 10:6185458-6185480 CCACTGCGGGGGCGAGGAGACGG 0: 1
1: 0
2: 1
3: 9
4: 119
Right 1063456369 10:6185496-6185518 GTCTCCCATCGGCTCACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063456361 Original CRISPR CCGTCTCCTCGCCCCCGCAG TGG (reversed) Intronic
900089578 1:914070-914092 CCCTGTCCTGGCCCCCACAGTGG + Intergenic
900357639 1:2272420-2272442 CCGTCTCCCCAACCCCCCAGCGG - Intronic
902169497 1:14598784-14598806 CCGCCGCCTCGCCACCGCCGCGG + Exonic
903813365 1:26046844-26046866 CCTTCTCCCCTCCCCCGCAGCGG + Intergenic
909677807 1:78257444-78257466 CAGTCTCCCCGCACCAGCAGGGG - Intergenic
915331704 1:155116743-155116765 CCTTCCCCTCGCCCATGCAGGGG + Intergenic
917450578 1:175144367-175144389 CCGTCTCTTCTCTCCTGCAGGGG + Exonic
919895703 1:202008452-202008474 CCGCCCCCCCGCCCCCGCACTGG - Exonic
1062874851 10:934816-934838 CCTTCTCCCCGTCCCCCCAGTGG + Intergenic
1063171942 10:3517053-3517075 CCGTGTCCTGGCCCCCGCACCGG - Intergenic
1063456361 10:6185458-6185480 CCGTCTCCTCGCCCCCGCAGTGG - Intronic
1068006163 10:51394014-51394036 CCTTCTCCTGGGCCCCTCAGAGG - Intronic
1070570546 10:77637264-77637286 CCTTCGTCTTGCCCCCGCAGTGG + Exonic
1075075255 10:119346249-119346271 ACCTCTCCTCGGCCCCGCTGCGG - Intronic
1077252973 11:1568760-1568782 CCGGCTCCCCGCCCCCTCAGAGG + Intronic
1078164486 11:8870846-8870868 CCGACTCCCGGCCCCGGCAGCGG - Intronic
1079362006 11:19777291-19777313 CGGTCGCCTCGCCCCCGCCCCGG - Intronic
1080360664 11:31509685-31509707 CCGCCTCCTCGCCCCAACCGCGG - Intergenic
1081502597 11:43681005-43681027 CCGCGTCCTCGCTCCCGCGGCGG + Intronic
1081967176 11:47177067-47177089 CCGTCGCCCCGCCCCGGCTGCGG - Exonic
1083625611 11:64070577-64070599 CCCTCCCCTCTCCCCCGGAGGGG + Intronic
1084118551 11:67055957-67055979 CCCCCACCCCGCCCCCGCAGAGG - Intergenic
1087640937 11:100753152-100753174 CAGTCCCCTCACCCCCACAGGGG - Intronic
1089352031 11:117827019-117827041 GCACCTCCTCCCCCCCGCAGTGG - Intronic
1090732239 11:129581782-129581804 CAGTCTCCTCACCTCTGCAGTGG - Intergenic
1096178600 12:49538886-49538908 CCACCTCCCCGCCCCCGCCGAGG + Intergenic
1096204162 12:49707287-49707309 CCGACTCCTCGGCCCCGTCGAGG + Exonic
1097848666 12:64390617-64390639 CCCTCTCCCCGCCCCCGCGCTGG + Exonic
1098697854 12:73581739-73581761 CCGTCTCTATGCCCCCACAGGGG + Intergenic
1100839078 12:98593861-98593883 CCGTCTCCACGCCCTTGAAGAGG - Intronic
1113961763 13:114130263-114130285 CCGTTTCCTCTCCCCTCCAGAGG - Intronic
1116872758 14:50083845-50083867 CAGTCTCCTCGCCCACCCACTGG + Exonic
1118339149 14:64880002-64880024 CCGCCTCCCCGCCCCCGCCGCGG - Intergenic
1122689126 14:103523192-103523214 CCGGCCCCTCGCCGCCGCCGCGG - Intergenic
1122802843 14:104240204-104240226 CAGCCTCCTCGCCCACACAGAGG - Intergenic
1123048161 14:105528304-105528326 CCCTCTCCCCGCCGCCGCACTGG - Intronic
1125541141 15:40470916-40470938 CCCTCTCCCCGCCCCCGGCGTGG + Intergenic
1129450450 15:75648330-75648352 CCCTCTCCCCGCCCCAGAAGTGG - Exonic
1132580784 16:683779-683801 TCCCCTCCCCGCCCCCGCAGAGG - Exonic
1132630075 16:913037-913059 ACGGCTCCTCTCCCCGGCAGTGG - Intronic
1132683396 16:1152879-1152901 CCCCCTCCACGCCCCCGCACTGG - Intergenic
1137588405 16:49678653-49678675 CCCTCTCCTCACCCCTGCACTGG + Intronic
1141913302 16:87075739-87075761 CCGTCTCCTCACACCCTCTGAGG - Intergenic
1142805341 17:2368442-2368464 CCCTTTCCCCGCCCCTGCAGAGG + Intronic
1143002374 17:3802701-3802723 TGGTCTCCTCTCCCCCGCATTGG + Intergenic
1145960526 17:28884263-28884285 CCGTCTCTACGTCCTCGCAGCGG + Exonic
1146167374 17:30600595-30600617 CCGTCTCCTCGCGGCCTCCGCGG - Intergenic
1147168832 17:38606526-38606548 CCGCCGCCTCGCCCCCGCTCCGG + Intergenic
1148847554 17:50538214-50538236 CCATCCCCTCCCCACCGCAGTGG - Intronic
1150373589 17:64662155-64662177 CCGCCTCCTCGCGGCCGCCGAGG + Intergenic
1152242447 17:79167636-79167658 CAGTCTGCCTGCCCCCGCAGAGG + Intronic
1152623746 17:81379142-81379164 CCCTCTCTGCGGCCCCGCAGGGG + Intergenic
1160454618 18:78992120-78992142 TGGTCTCCTCGCCCCCGCTGCGG - Exonic
1160979862 19:1811971-1811993 CCGTCTTCCCGCAGCCGCAGGGG + Intronic
1161028313 19:2046689-2046711 TCCTCTCCTCTCCCCTGCAGGGG - Exonic
1161400677 19:4065399-4065421 CCGCCGCCTCGCCCGCGCGGGGG + Intronic
1162116135 19:8430638-8430660 CCCTATCCTCTCCCCTGCAGTGG + Exonic
1162909883 19:13842955-13842977 CCGTCTCCTCCCCCCCTCCCCGG + Intergenic
1162932708 19:13965378-13965400 CCGTCTCCTCTGCTCCCCAGGGG - Intronic
1163298609 19:16429207-16429229 TCGTCTCCACTCCCCAGCAGTGG + Intronic
1164862735 19:31575460-31575482 CCGTCTTGTCACCCCAGCAGGGG - Intergenic
1165360900 19:35336387-35336409 CCTTCTCCCCAGCCCCGCAGGGG + Intronic
1166765671 19:45251316-45251338 CCGGCTCCGCGCCCCCTCCGCGG + Exonic
1166862480 19:45818268-45818290 GAGTCTCCTCTCTCCCGCAGGGG - Intronic
926155101 2:10448985-10449007 CCGCCTCCACGCCCCCGCGCTGG + Intergenic
926914406 2:17878690-17878712 CGCTCTCCTCGCCGCCGCGGCGG + Intronic
927216573 2:20670878-20670900 TCGTCTCCTCCCGCACGCAGAGG + Exonic
927502664 2:23592788-23592810 CCATCTCCTGGCCCCCAAAGGGG + Intronic
927554084 2:24020442-24020464 CCCTCTCCTCCCCTCCCCAGAGG + Intronic
931614620 2:64143937-64143959 CCGCCTGCGCGCCCCCGCTGCGG - Intronic
935349684 2:102142695-102142717 CCCGTTCCCCGCCCCCGCAGCGG + Intronic
938405736 2:131032193-131032215 CCCCCTCCTCGGCCCCACAGAGG - Intronic
940971989 2:159904832-159904854 GCGTCTCCTCGGCCCCGGGGCGG + Intergenic
941028097 2:160480833-160480855 CCGTCACCTCGGCCTCCCAGTGG - Intronic
946328735 2:218998011-218998033 CCCTCTCCTCTGCCCCTCAGTGG + Intergenic
948430157 2:237913628-237913650 CCGTCTCCTCGCCCTCACTGGGG - Intergenic
948696446 2:239735335-239735357 CTTTCTCCTGGCCCCGGCAGGGG - Intergenic
1169320227 20:4626274-4626296 CCCTCTCCTGTCCCCCGAAGTGG + Intergenic
1170548425 20:17454879-17454901 GCTTCTCCTCGCTCACGCAGGGG - Intronic
1171403011 20:24891764-24891786 CCATCTCCACCTCCCCGCAGAGG - Intergenic
1171464070 20:25315631-25315653 CCAGCTCCTAGCCACCGCAGAGG + Intronic
1175216231 20:57392856-57392878 CCCCCTCCTCGCCCCAGCAGTGG + Intronic
1177577803 21:22981828-22981850 CTGTCCCCACGCCCCGGCAGTGG + Intergenic
1179245030 21:39625686-39625708 CCTTCCTCTCACCCCCGCAGGGG + Intronic
1180837084 22:18935272-18935294 CCCTCACCTCGCACCCGCCGAGG + Intronic
1180997734 22:19973791-19973813 CCCTCTCCCCGCCTCCGCAGTGG - Exonic
1181064873 22:20300751-20300773 CCCTCACCTCGCACCCGCCGAGG - Intergenic
1184225927 22:43128864-43128886 CCGTCTCCTGGCCAGGGCAGGGG + Intronic
1184486533 22:44783293-44783315 CCCCCTCCCCACCCCCGCAGCGG + Intronic
1184642713 22:45880842-45880864 CCTTCTCCTCCTCGCCGCAGGGG - Intergenic
1203287177 22_KI270734v1_random:160571-160593 CCCTCACCTCGCACCCGCCGAGG + Intergenic
950509251 3:13415912-13415934 CCCTCTCCCTGCCCCAGCAGGGG - Intronic
954660632 3:52225006-52225028 CAGTCTCCTCGTCCCCTCTGGGG + Intronic
954912782 3:54122670-54122692 CGCTCTCGTCGCCGCCGCAGCGG + Exonic
962695853 3:137946498-137946520 CCTTCGCCCCGCCCCCGCAAAGG - Intergenic
962864385 3:139435168-139435190 CCATTTCCTCCCCCACGCAGTGG - Intergenic
962925538 3:139989563-139989585 CCTTCTCCTGGACCCAGCAGAGG + Intronic
963870254 3:150408572-150408594 CCGTCGCCGCCCGCCCGCAGGGG + Exonic
966096754 3:176213504-176213526 CCTTCCCCCGGCCCCCGCAGTGG - Intergenic
966108179 3:176362313-176362335 CCCAAGCCTCGCCCCCGCAGTGG - Intergenic
966911600 3:184562843-184562865 CCGCCTGTCCGCCCCCGCAGCGG - Intronic
975446374 4:74470064-74470086 CCCCCTCCTCACCCCTGCAGTGG - Intergenic
985529904 5:427914-427936 CGTTCTCCTCCCCTCCGCAGCGG + Exonic
990581678 5:57172630-57172652 CCCTTTCCTCTGCCCCGCAGAGG + Intergenic
992269978 5:75053724-75053746 GCGCCTCCGCGCTCCCGCAGAGG + Intergenic
1001093762 5:168760722-168760744 CCTTCTCCTCAGCCCCGCTGTGG - Intronic
1003869406 6:10390302-10390324 CAGCCTCCCCGCCCCCGCCGGGG + Intergenic
1003908502 6:10723123-10723145 CCCTCTCCTCGCCCCGCCACCGG + Exonic
1004905451 6:20233446-20233468 GAGTCTCCCCGCCCCCGCCGTGG + Intergenic
1006012452 6:31054223-31054245 CCTTCTCCTTCCACCCGCAGTGG - Intergenic
1012910270 6:105110059-105110081 CCTGCTCCTCGCCCCAGGAGGGG - Intronic
1019937767 7:4267486-4267508 CCTTCCCCTCGGCCCCGGAGAGG + Exonic
1022322088 7:29297228-29297250 CAGGCTCCTCGCCCCTGCAAAGG + Intronic
1026653664 7:72237531-72237553 CTGTCTCCTGGCCCTCGCTGTGG - Intronic
1035435642 7:158857017-158857039 CCGTCTCCTCGCGCCCGGCCTGG + Intronic
1035732023 8:1860197-1860219 TCCTCTCCACGCCCCCGAAGTGG + Intronic
1035732034 8:1860232-1860254 TCCTCTCCACGCCCCCGAAGTGG + Intronic
1037643676 8:20771214-20771236 CAGTCTCCTCTTCCCCTCAGAGG + Intergenic
1041895053 8:62914945-62914967 CCCTCTCCTTGCCCCCCCACAGG + Intronic
1043035205 8:75188886-75188908 CCATCTCCTCGCTGCCCCAGAGG - Intergenic
1055383114 9:75730637-75730659 CTGTTTCCTCGCCCCCTCAATGG - Intergenic
1059455309 9:114396896-114396918 CCTTCTCCACGCCCCCACGGGGG + Intergenic
1061618348 9:131794563-131794585 CCGTCCCCTCCTCCCTGCAGAGG - Intergenic
1062021458 9:134321369-134321391 CCATCTCCTCGCCGCCGCAGAGG + Intronic
1062341417 9:136095316-136095338 CCGCCGCCCCGCCCCCGCCGCGG - Intergenic
1185610568 X:1391858-1391880 CCGTCCCCTAGTCCCCGGAGCGG + Intronic
1190714005 X:53088761-53088783 CCTTCTCCTGGCGCCCGCAGCGG + Intergenic
1191908472 X:66121854-66121876 CCCTCCCCTTGCCCCCTCAGGGG + Intergenic
1192251440 X:69417041-69417063 CCCTCTCCCCCCCCCCGCCGTGG + Intergenic
1195379233 X:104255284-104255306 TCGTCTCCTCGCCCCCAAATCGG - Intergenic