ID: 1063456693

View in Genome Browser
Species Human (GRCh38)
Location 10:6188174-6188196
Sequence CTGAAGTACTTAGGGACAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 10, 3: 52, 4: 262}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063456693_1063456699 22 Left 1063456693 10:6188174-6188196 CCTTTTGTCCCTAAGTACTTCAG 0: 1
1: 0
2: 10
3: 52
4: 262
Right 1063456699 10:6188219-6188241 ACAGTATCATGATTGAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063456693 Original CRISPR CTGAAGTACTTAGGGACAAA AGG (reversed) Intronic
901584312 1:10275028-10275050 CTGAAGTGTTTAGGGGTAAATGG + Intronic
902626777 1:17681249-17681271 CCGAAGTATTTAGGGGTAAAGGG - Intronic
902863527 1:19262382-19262404 CTGAAGCACTGAGGGGCTAATGG + Intergenic
903748683 1:25604782-25604804 CTCAAGTACCCAGGGACACAAGG + Intergenic
903944959 1:26956773-26956795 TTGAAGCACTTGGGGATAAAGGG + Intronic
904701881 1:32362593-32362615 ATGAAGTCCTTGGGGAGAAAAGG + Exonic
905510919 1:38519270-38519292 CTGAAGTCTTTAGGGGTAAAGGG + Intergenic
905809476 1:40901529-40901551 CTAAAGTATTTAGGAACAAAAGG + Intergenic
907043564 1:51284948-51284970 TTGAATTGCTTAGGGACACAAGG + Intergenic
908013271 1:59805382-59805404 CTGAAGTATTTAAGGGCTAACGG + Intergenic
908020690 1:59895165-59895187 ATGAAGGACTTTGGGACAACTGG - Intronic
908419010 1:63941261-63941283 CTGAAATATTAAGGGGCAAAGGG + Intronic
908653757 1:66365243-66365265 CTGAATAACTTAGAGAAAAATGG - Intronic
909427531 1:75544575-75544597 CTGAAGTATTTAGAGATAAAGGG - Intronic
910052101 1:82986965-82986987 CTACAATAATTAGGGACAAATGG + Intergenic
910929500 1:92428918-92428940 ATGAGGTACTTAGAGACATAAGG + Intergenic
915037404 1:152940568-152940590 CTGAAATATTTAGGGGCAAAGGG - Intergenic
915840755 1:159211186-159211208 CTGGAGGACTTAGGGAGAAGAGG - Intergenic
916091483 1:161310562-161310584 CTGAAGGACTTCTTGACAAACGG - Intergenic
916213608 1:162377767-162377789 TTGAAGTACTTAGGTATAAAAGG - Intronic
916893798 1:169140065-169140087 CTGAAGTATTGAGAGATAAAGGG + Intronic
918257309 1:182760811-182760833 CAGACGTATTTAAGGACAAAGGG + Intergenic
921232229 1:213084481-213084503 CTGAAGTGCTTAGGAGTAAAGGG - Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921940832 1:220837725-220837747 TTGAAATATTTAGGGATAAAGGG + Intergenic
922231888 1:223694719-223694741 CTGAAGTACTTAGGAGTAAATGG + Intergenic
923293801 1:232573373-232573395 CTGAAGTGCTTAGGGGTAAAAGG + Intergenic
923308786 1:232713804-232713826 CTGTAGAATTTAGGGATAAAGGG - Intergenic
923955515 1:239014106-239014128 CTGAACTAATTAGGCAGAAAGGG - Intergenic
924461518 1:244263692-244263714 GTGAAGTACTTAGGGGTAAAAGG + Intergenic
924469510 1:244328942-244328964 ATGAGGTACTTAGGGAAAGATGG - Intergenic
1063456693 10:6188174-6188196 CTGAAGTACTTAGGGACAAAAGG - Intronic
1064333921 10:14421128-14421150 CTGAAGTATTTAGTGGTAAAGGG + Intronic
1065346996 10:24758003-24758025 CTAAAATACTGAGGGAAAAAAGG - Intergenic
1065476178 10:26140290-26140312 CTTAAATATTTAGGGCCAAACGG - Intronic
1070239569 10:74665028-74665050 CTGAAGTATTAAGGGGTAAAAGG + Intronic
1071596577 10:86932224-86932246 CTGAAGTATTTAGGGATAAAGGG - Exonic
1072002197 10:91207487-91207509 CTGAAGTATTTAGAGGTAAAGGG - Intronic
1072107407 10:92287877-92287899 CTGAAGGAGTTGGGGAGAAATGG - Intronic
1073003467 10:100302945-100302967 TTGAAGTATTTAGGAACAAAAGG + Intronic
1073771711 10:106742217-106742239 CTGAAGTACTTGGGACCAGAAGG + Intronic
1075119964 10:119657588-119657610 CTGCAGTTCTTAGGAACCAATGG - Intronic
1075600954 10:123768758-123768780 TTGAAACACTTAGGGCCAAACGG + Intronic
1075977883 10:126712497-126712519 CTGAAGAATTTAGGGGTAAAAGG + Intergenic
1076489673 10:130849675-130849697 GTGAAGTGTTTAGGGATAAAAGG - Intergenic
1078275810 11:9844979-9845001 GTGATGTACTTAAGGATAAAGGG + Intronic
1078744816 11:14102035-14102057 CTGAAGTATTTAGAGGTAAAAGG - Intronic
1079221616 11:18567088-18567110 TTAAAGTACTTAGGGGTAAAAGG - Intronic
1079481239 11:20882607-20882629 CTGAAGTATTTAGGGGTAGAGGG - Intronic
1081368477 11:42266995-42267017 CTGAGGTACTTAGAAACAAGTGG - Intergenic
1081873742 11:46395107-46395129 CCCAAGTACTTAGGGACTACAGG + Intergenic
1083129266 11:60608506-60608528 CTGATCTACTAAGGGAAAAATGG - Intergenic
1083663062 11:64260933-64260955 CTGAAGTATTTATGGGTAAAGGG + Intronic
1083982139 11:66180974-66180996 CTGAAGTAATTAGAAATAAAAGG - Intronic
1084797793 11:71519588-71519610 CTGCAGTACTTAGGGGCCCAGGG - Intronic
1085945390 11:81264996-81265018 CTGAAGTATTTAGAAATAAAGGG - Intergenic
1086280316 11:85178243-85178265 GTGAAGTATTCAGGGAAAAAAGG + Intronic
1088047239 11:105468897-105468919 CTGAAGTACTGGTGGGCAAAGGG - Intergenic
1088275333 11:108079545-108079567 CTGAAGTGTTTAGGGACTAAAGG - Intronic
1089906835 11:122048594-122048616 CTGCAGTACTTAGGGCCCATGGG - Intergenic
1090190815 11:124766241-124766263 TTGATGTACTTAGGGTCAAAAGG + Intergenic
1090336434 11:125970933-125970955 CTGAATTTCTTAGGGAAATAGGG + Intronic
1090789023 11:130074013-130074035 CTGAAGTTCTCAGGGGTAAAGGG - Intronic
1091251147 11:134145401-134145423 CTGAAGTATTTATGGATAAAAGG + Intronic
1092780352 12:11980538-11980560 ATAAAGAACTTAGAGACAAAAGG + Intergenic
1093358034 12:18193944-18193966 CTGGCGTATTTAGGGACAAAGGG + Intronic
1096040654 12:48513217-48513239 CTGAAGTGGTTAGGGGGAAAAGG + Intronic
1096431223 12:51544872-51544894 CTGAAGTATTTAGGAGTAAAGGG - Intergenic
1097533983 12:60841463-60841485 CTTAGATACTTACGGACAAATGG + Intergenic
1099051240 12:77783807-77783829 CTGAGGTGAGTAGGGACAAAGGG + Intergenic
1099917744 12:88915916-88915938 ATGAAGTACAGAGGAACAAAAGG + Intergenic
1100250494 12:92817202-92817224 ATGAAGTACAGAGGGAAAAAAGG - Intronic
1100365579 12:93917284-93917306 CTAAAGTATTTAGGGGCAATGGG + Intergenic
1101325806 12:103714785-103714807 CTCAAGTATTTAGGAACAAAGGG - Intronic
1102196745 12:111031317-111031339 CTGAAGTATTTAGGGATAAAGGG - Intergenic
1102526679 12:113517091-113517113 CTGAAGTGCTTAGCGGTAAATGG - Intergenic
1102740341 12:115201377-115201399 CTGAAGCCCTTAGGGAAAGAAGG - Intergenic
1104045220 12:125157808-125157830 ATGGAGTATTTAGGGACAAAGGG - Intergenic
1104425690 12:128675944-128675966 CTGAAGTAGTTAGAGTTAAAAGG - Intronic
1105471474 13:20698808-20698830 CTGAGGTGCTGTGGGACAAAGGG + Intergenic
1106711766 13:32343451-32343473 CAGAATGACTTAGGGGCAAAAGG - Intronic
1106963533 13:35031581-35031603 GTTAAGTACTTAGGCACAATGGG - Intronic
1107909397 13:45091202-45091224 CTGAAATATTTAAGGGCAAAGGG + Intergenic
1110538479 13:76680244-76680266 TTGACATACTTTGGGACAAAAGG - Intergenic
1111339652 13:86866955-86866977 CTGAAGTATTTAGGGGTAAAGGG - Intergenic
1113116015 13:106875655-106875677 CAGAAGACCTTTGGGACAAATGG + Intergenic
1115725167 14:36206544-36206566 CTGAAGTACTTGGGAGTAAAGGG - Intergenic
1117127266 14:52642569-52642591 CTGAAGTATTTAGGGTTTAAGGG + Exonic
1118375526 14:65173588-65173610 CTCAAGTATTTAGGGATAAAGGG + Intergenic
1118697595 14:68399693-68399715 CTGAAGTATTTGGGGATGAAAGG - Intronic
1120897065 14:89543014-89543036 GTGAAGTATTTAGCTACAAAAGG + Intronic
1121391412 14:93578660-93578682 CTGAAGTGTTTAGGGATAAAAGG - Intronic
1121653730 14:95579463-95579485 CTGAAGTATTTAGGAATAAAGGG - Intergenic
1123894825 15:24818229-24818251 CATAAGTACATATGGACAAAAGG + Intergenic
1125664641 15:41420626-41420648 CTGAAAAACCCAGGGACAAAAGG - Intronic
1127072495 15:55300180-55300202 ATGAAATACTCAGGAACAAAAGG + Intronic
1128342556 15:66832698-66832720 CTGAAGCATTTAGGGTTAAAGGG - Intergenic
1130037219 15:80371915-80371937 CAGAAGCCCTTTGGGACAAAGGG + Intronic
1130201993 15:81840105-81840127 TTGAAGTACTCAGGGGCAAAGGG + Intergenic
1130226335 15:82061077-82061099 CTGAAGAATTTAGGGGTAAAGGG - Intergenic
1130630577 15:85564409-85564431 CTGAAATATTTAGGAACAGAAGG - Intronic
1133538942 16:6729830-6729852 CTGAAGTATCGTGGGACAAATGG + Intronic
1134003587 16:10802031-10802053 TTGAAGTATTTAGGGGCAAGTGG + Intronic
1134199510 16:12186431-12186453 CTTGAGTATTTAGGGGCAAATGG - Intronic
1138359342 16:56413996-56414018 CTGAAGTATTTAGGGGTAAAGGG + Intronic
1139324561 16:66142159-66142181 CTGTACTCCTGAGGGACAAAAGG + Intergenic
1139662346 16:68429731-68429753 ATGAAGGACTTGAGGACAAAGGG + Intronic
1140083279 16:71771111-71771133 ATGAAGTATTGAGGGAGAAAGGG - Intronic
1140633727 16:76886200-76886222 CTGAAGTACTCACAGATAAAAGG + Intergenic
1143357397 17:6340590-6340612 CACAAGCACTTGGGGACAAATGG - Intergenic
1146608906 17:34287512-34287534 CTTAAATATTTAGGGTCAAATGG + Intronic
1146746588 17:35336253-35336275 CTGAAGTATTTAGAGGTAAATGG + Intergenic
1146756533 17:35437017-35437039 CTGAAGTATTTAGTGGTAAATGG + Exonic
1148119381 17:45198853-45198875 CTGAAGTATTTGGGGGCAAAGGG - Intergenic
1149190397 17:54054532-54054554 CTGAAGTAAGTGGGGAGAAATGG - Intergenic
1149722235 17:58857123-58857145 GTGAAGTATTTAGGGATAACAGG - Intronic
1149738373 17:59018161-59018183 ATGAATTAATTAGGGAAAAAAGG + Intronic
1150639750 17:66941610-66941632 CTGCAGTACTCAGGGACACGTGG + Intergenic
1150688799 17:67344941-67344963 CTGAACTACTGTGGGAAAAATGG - Intronic
1152022318 17:77786651-77786673 CTGGAGTTCTCAGGGACTAATGG - Intergenic
1153283094 18:3432555-3432577 CTGAAGTATTTAGGGCACAAAGG + Intronic
1156386607 18:36610830-36610852 GTGAAGTAAGTAGGGACTAAAGG + Intronic
1158249792 18:55475011-55475033 CAGAAGTACTAAGGTGCAAAAGG - Intronic
1158473088 18:57755958-57755980 CTGAAGTATTTAGGGGTAAAGGG - Intronic
1158774897 18:60565609-60565631 CTGAAGAATTTAGGGCTAAAAGG + Intergenic
1159644993 18:70907401-70907423 ATGAAGAACTTAGGGAAACATGG - Intergenic
1161812640 19:6479394-6479416 CTCAAGGACTCAGGGACACAAGG - Intronic
1161921020 19:7265995-7266017 CTGAGGTACTAAAAGACAAATGG + Intronic
1161965891 19:7548590-7548612 CTGTATTATTTAGGGAAAAACGG + Intronic
1162391036 19:10390354-10390376 CTGAAGGCCATAGGGACAAAAGG + Intergenic
1162888002 19:13710732-13710754 CTGAAGTATTGAGGGATAACAGG + Intergenic
1164924245 19:32114823-32114845 ATGAAGTATTTAGGGGTAAAGGG + Intergenic
1166624671 19:44339839-44339861 CTGAAGTATTTAGAGAAAAACGG + Intronic
1166681473 19:44770122-44770144 CTGAAGCATTTAGAGGCAAAGGG + Intergenic
1167131633 19:47590171-47590193 CTGAAGGATTTAGGGATCAAGGG + Intergenic
925288925 2:2733836-2733858 CTGGAGGACTGAGGGAGAAATGG - Intergenic
925659079 2:6183578-6183600 CTGAAGTCCTGAAGGATAAAGGG - Intergenic
926014073 2:9433572-9433594 CTGAACTTCTTAGAGAAAAAGGG - Intronic
927445272 2:23154934-23154956 CTAAAGTACTTAGGGACAATGGG + Intergenic
927757511 2:25720967-25720989 TTCAAGTATTTAGGGAAAAATGG - Intergenic
928025314 2:27734918-27734940 CTGAAGTATTTAGGGATAAAGGG - Intergenic
928156411 2:28881011-28881033 CTGAAGTATTTAGGGATAAAGGG - Intergenic
928401411 2:30981236-30981258 TTGAAGCACTTGGGGGCAAATGG + Intronic
929584170 2:43103029-43103051 CTGAAGTATTTAAGGGTAAAGGG + Intergenic
929590772 2:43144519-43144541 CTGAAGTATTTAGAGGTAAAAGG + Intergenic
930072177 2:47375614-47375636 CTGAAGTACTTAGGGGTAAAGGG - Intronic
930148697 2:48035018-48035040 CTGAAATATTTAGGGATAAAGGG - Intergenic
930371287 2:50504356-50504378 CTGAAGTATTTCGGGTTAAAGGG + Intronic
931035595 2:58239692-58239714 CTCAAGTATTTAGGGATAAAGGG + Intronic
931364769 2:61609639-61609661 CTGAAGTGGTTAGGGGTAAAGGG - Intergenic
932708385 2:74044781-74044803 CTGAAGTATTTAGGAGTAAAGGG - Intronic
932997272 2:76870441-76870463 CTGAAATACTGGGGGAAAAAAGG + Intronic
933586704 2:84187123-84187145 CTGAAATACTGGGGGAGAAATGG - Intergenic
935820877 2:106891557-106891579 ATGAAGTATTTAGGGTTAAAGGG - Intergenic
935940639 2:108234883-108234905 CTCAAATACTTAAGCACAAATGG + Intergenic
936285052 2:111175271-111175293 CTGAAGTATTTAGGGGCAAGGGG + Intergenic
937165431 2:119810844-119810866 CTGAAGTACTTACTTTCAAAAGG - Intronic
938918758 2:135972554-135972576 CTGAAGTAGAAATGGACAAATGG + Intronic
941469525 2:165867192-165867214 CTGAAGTACTTAGGGGTACAGGG + Intronic
942211978 2:173680410-173680432 CTGAAGTATTTAGGTGTAAAGGG + Intergenic
945125463 2:206504900-206504922 CTGAAATATTTAGGTACAGACGG - Intronic
945281324 2:208038090-208038112 CTGGGGAACTTATGGACAAAAGG - Intergenic
945513921 2:210738431-210738453 TTGAAGTATTTAAGGATAAAGGG - Intergenic
946283287 2:218682360-218682382 CTAAAGTATTTAGGGGTAAAGGG - Intronic
946565756 2:220963628-220963650 CTAAAGTATTTAGGGGTAAAGGG - Intergenic
1170313879 20:15022325-15022347 CTGAAGTATTTAGGATCTAATGG + Intronic
1170849220 20:19989027-19989049 TTGAAGTATTTAGGGGTAAAGGG - Intronic
1172259979 20:33555594-33555616 TTTAAGTATTTAGGGATAAAAGG - Intronic
1172911119 20:38409764-38409786 CTGAAGTATTAAGGGGTAAAGGG + Intergenic
1174382388 20:50164617-50164639 CTGAAGAATTTAGGGTAAAAAGG - Intergenic
1174599003 20:51709122-51709144 CTTAAGTATTTAGGCACAAAAGG + Intronic
1174655116 20:52165320-52165342 CTGAAGTATTTAGGAATAAAGGG + Intronic
1175762275 20:61569537-61569559 CTGAAGTATCTAGGGGCAACAGG - Intronic
1178052284 21:28761205-28761227 CTGAAGAATTTAGGTATAAATGG + Intergenic
1178224264 21:30697386-30697408 TTAAAGTACATAAGGACAAATGG + Intergenic
1178306480 21:31494979-31495001 CTGAAGTACTTAGGCAGCAAAGG + Intronic
1178628458 21:34238626-34238648 CTGAAGTCCTGAGGGTCAAGAGG - Intergenic
1178911579 21:36678658-36678680 CTAAAGTATTTGGGGATAAAGGG + Intergenic
1179983727 21:44910014-44910036 TTGAAGTACTAAGAGACAAAGGG + Intronic
1180238244 21:46478878-46478900 CAGAAGTAATTAGGCACATATGG - Intronic
1182385174 22:29932923-29932945 CTCAAGTATTTAGAGGCAAAGGG - Intronic
1184151188 22:42639747-42639769 CTGAAATATTTAGGGGCAAAGGG + Intronic
1184935857 22:47719953-47719975 CTGAAATCCTTAGGCTCAAAAGG + Intergenic
951379440 3:21965777-21965799 CTGAAGTATTTAGGGATAAAAGG + Intronic
951407503 3:22318196-22318218 CTGATGTAGCTAGGGGCAAATGG + Intronic
951870200 3:27353454-27353476 CAGAAGTATTTAGAGGCAAAAGG + Intronic
951889957 3:27559178-27559200 CTGAAGTATTTAGGAATAAAGGG + Intergenic
952025842 3:29080898-29080920 GTGAAATATTTAGGGAAAAATGG + Intergenic
952245074 3:31579162-31579184 ATAAAGTACTTAGGGATAAAAGG - Intronic
952285765 3:31968144-31968166 CTGAAGTATTTAAGGGTAAAGGG - Intronic
952411888 3:33056765-33056787 CTGATGTATTTAGGGATAAAGGG - Intronic
953175192 3:40544916-40544938 CTGAAGTATTTATAGAAAAAGGG + Intronic
954415786 3:50392607-50392629 CAGAAGTACTCAGGGCCCAAGGG + Intronic
954668698 3:52275905-52275927 TTGAAGTGTTTAGGGATAAAGGG + Intronic
955205988 3:56896356-56896378 CTGAAGTATTTAGGGTCTAAAGG - Intronic
955350655 3:58190736-58190758 TTGCAGTACTTTGGGACAGAAGG + Intergenic
956389274 3:68754120-68754142 GTGAAGTAGTTAGGGGTAAAGGG - Intronic
956453523 3:69397706-69397728 CTGAGGGAATTAGGGAGAAATGG + Intronic
957761188 3:84559176-84559198 CTGAAGTGCTAATGGTCAAATGG + Intergenic
960980636 3:123221954-123221976 CTGAAGTAGTTATGAAGAAAGGG - Intronic
961220944 3:125199169-125199191 CTGAAATATTTATGGATAAAAGG + Intronic
962372214 3:134830222-134830244 CTGAAGTAATTAGGAGTAAATGG - Intronic
962585158 3:136834992-136835014 CTTAAGTAGTTAGGGATAATTGG - Intronic
964454557 3:156848170-156848192 CTGAACTAATTAGGAACAGATGG - Intronic
965020973 3:163230752-163230774 AAGAAGTCCTTAGGGACCAATGG + Intergenic
965033590 3:163405629-163405651 CTGCATCACTTAGGGACTAAGGG + Intergenic
966316063 3:178646456-178646478 CTGAACCTCTCAGGGACAAAGGG + Intronic
966405219 3:179590376-179590398 CTGTATGACTAAGGGACAAAAGG + Intronic
966841351 3:184090788-184090810 CTGAAGTAGTTAGGGTTAAAGGG - Intergenic
967286633 3:187877623-187877645 CTGAAGTATTTAGGAGTAAAAGG + Intergenic
971442741 4:26706736-26706758 TAGAAATACTTAGAGACAAATGG - Intronic
972480874 4:39494639-39494661 CTGAAGTATTTAGGGGAAAAGGG + Intergenic
973605045 4:52578281-52578303 CTGAAGTAATCAGGAGCAAAGGG + Intergenic
973689611 4:53412219-53412241 CTTAAGTACTTAAGGGTAAAGGG - Intronic
976616301 4:87080970-87080992 CAAAAGTATTTAGGGATAAAGGG + Intronic
977700708 4:100019668-100019690 CTGAAGTATTTAGGGAGTAGAGG - Intergenic
977828411 4:101560645-101560667 ATGAATTACTTAGGATCAAAAGG - Intronic
978828299 4:113051089-113051111 CTGGAATGCTTAGGTACAAAAGG - Intronic
979212860 4:118127015-118127037 CTGAATAACTAATGGACAAAGGG - Intronic
979424482 4:120548594-120548616 CTGAACAACTGAGGAACAAACGG - Intergenic
980495235 4:133581034-133581056 ATGAATTACTGAGGGAAAAAGGG + Intergenic
985190213 4:187364881-187364903 CTGAAGTATTTAGGAGTAAAGGG + Intergenic
987856964 5:23432425-23432447 CTGAAGTATTTAGGGGTTAAGGG - Intergenic
990341002 5:54822952-54822974 CTGAAATATTTAGAGATAAAGGG + Intergenic
990589285 5:57245814-57245836 CTGAAGTATTTAGAAATAAAAGG + Intronic
992019108 5:72605011-72605033 CCTAAGTACTTAGAGACACATGG - Intergenic
992058857 5:73021462-73021484 CTAAAGTACTAAAGGAAAAAAGG - Intronic
992060979 5:73047230-73047252 CTTAAGTATTTAGAGACAAAGGG - Intronic
995451562 5:112307527-112307549 GTGTACTACTTAGGAACAAAAGG - Intronic
995520392 5:112998801-112998823 CAGAAGCAATTAAGGACAAAGGG - Intronic
996297324 5:121936667-121936689 CTCAAGTGCTTAGAGACATATGG + Intergenic
996729968 5:126707460-126707482 CTGCAGTAATTGGGGAAAAAAGG + Intergenic
998709317 5:144804758-144804780 CTGAAATATTTAGAGATAAATGG - Intergenic
999698983 5:154210877-154210899 CTGAAGAATTTAGGAATAAAGGG + Intronic
1000213754 5:159135294-159135316 CTGAAATATTTAGGGTTAAAAGG + Intergenic
1000343826 5:160297695-160297717 CTGAAGTATTAAGGGATAATAGG + Intronic
1000729374 5:164812966-164812988 CTGAACTGCTTATGGACTAAAGG - Intergenic
1001074273 5:168613863-168613885 CTGATGTATTTAGGGGTAAAGGG + Intergenic
1001973061 5:175972273-175972295 CTGAAATATTTAGGGGTAAAGGG - Intronic
1002244373 5:177871509-177871531 CTGAAATATTTAGGGGTAAAGGG + Intergenic
1002359253 5:178657475-178657497 CTGATGGACTTATGGACATAGGG + Intergenic
1002669492 5:180855074-180855096 CTGAAGTATTTAGGGATAAAGGG + Intronic
1003229728 6:4241163-4241185 CTGAAGCAATTGAGGACAAATGG + Intergenic
1003779694 6:9410484-9410506 CTGAAGTATTTAGGGGTAAAGGG - Intergenic
1004490818 6:16113404-16113426 CTGAAGTATTTAGGAATAAGAGG + Intergenic
1007487633 6:42192903-42192925 CTGAAATACTTAGGGATAAACGG + Intronic
1010207527 6:73336214-73336236 CTGAAGTATTGAGGGATAAATGG + Intergenic
1010431853 6:75786823-75786845 CTGAAGTGTTTAGGGGTAAAGGG - Intronic
1010712542 6:79192104-79192126 CTGAAGTGTTGAGGGATAAATGG - Intergenic
1010760613 6:79718343-79718365 CTGGAGTTCTTAGTGCCAAAAGG + Intergenic
1011111424 6:83840852-83840874 CTGAAATATTTAGGGATAAAGGG + Intergenic
1011543518 6:88459224-88459246 CTGTATTCCTTAGGGAAAAATGG + Intergenic
1011689177 6:89850014-89850036 CTGAAATACTTAGGGGTAAGGGG - Intronic
1012995529 6:105969281-105969303 CTGAAGTATTTATTGATAAAGGG - Intergenic
1013062472 6:106648396-106648418 CTAAAGTATTTAGGGATAAAGGG + Intronic
1013403952 6:109825775-109825797 CTGAAATATTTATGGATAAACGG + Intergenic
1014010620 6:116471445-116471467 CTGTAGGGCTTAGGGACAAGGGG - Intergenic
1015638183 6:135301335-135301357 CTGAAATAATTAGGAACATATGG - Intronic
1015778422 6:136838688-136838710 CTGAAGTATTTAGGAATAAAAGG + Intronic
1015791453 6:136968266-136968288 CGGAAGGACTTAGGGATGAACGG - Intergenic
1015926507 6:138315058-138315080 TTTAAGTACTTAGGCACCAATGG - Intronic
1019829216 7:3309934-3309956 CTGAACTACTTAAGAAAAAAAGG + Intronic
1021355158 7:19645017-19645039 CTGAAGTTCTTTGGAAGAAATGG - Intergenic
1022649732 7:32263459-32263481 CTTAAGTATTTAGGGGTAAAAGG - Intronic
1023066148 7:36379558-36379580 CTGAACTGTTTAGGGAGAAAAGG - Intronic
1023534604 7:41194985-41195007 CTGAAGGCCTGAGGGACCAAGGG + Intergenic
1024103421 7:46057080-46057102 CTGAAAAACATAGTGACAAATGG + Intergenic
1024822972 7:53355280-53355302 TTGAAGGACTTAGTCACAAACGG + Intergenic
1026549255 7:71353312-71353334 CTGAAGTATTCAGAGACAAAGGG - Intronic
1026618321 7:71927764-71927786 CTGCAAGACTTAGGGACACAGGG - Intronic
1030033676 7:105390132-105390154 CTGAAATATTTAGGGATAAAGGG - Intronic
1030583594 7:111389483-111389505 CTGAAGTACTAAGGGAGTACTGG + Intronic
1031153497 7:118082113-118082135 CTGAAGTATTTATGGGAAAAAGG + Intergenic
1032108607 7:129055804-129055826 ATGGAGAAATTAGGGACAAAAGG + Intergenic
1032754963 7:134880963-134880985 ATGAGGCACTTAGGGACTAAAGG - Intronic
1032910884 7:136428307-136428329 CAGAAGTACTCAGTCACAAAGGG - Intergenic
1034281119 7:149855079-149855101 ATGAAGTATTTAGGAATAAAGGG + Intronic
1034540206 7:151753365-151753387 CTGAAATATTTAGGGGTAAAGGG + Intronic
1039766459 8:40633459-40633481 GTGAAGTATTGAGGGACAAGGGG + Intronic
1040926630 8:52690916-52690938 CTGAAGTATTTATGGATAAAGGG - Intronic
1041475055 8:58255410-58255432 CTGAAGTATTTAGCAATAAAAGG + Intergenic
1042041957 8:64601410-64601432 CAGAGGTACTGAGGGATAAAGGG - Intronic
1042282878 8:67073689-67073711 CTGAAGAGCTTAGGGGCAAAGGG + Intronic
1043207156 8:77459812-77459834 ATGAAGTGCTTAGGAAAAAAAGG + Intergenic
1043215976 8:77588770-77588792 TTGATGTATTTAGGGGCAAAGGG + Intergenic
1043753666 8:83973425-83973447 CTGAAGTAACGAGCGACAAATGG - Intergenic
1046485506 8:114882673-114882695 ATGAAGTAATAAGGGAAAAAAGG + Intergenic
1046596001 8:116261995-116262017 CTGGAGTATTTGGGGCCAAATGG - Intergenic
1047833467 8:128661334-128661356 CTGACGTATTTAGGGATAAAGGG + Intergenic
1049648293 8:143747569-143747591 AGGAAATACTTAGGAACAAATGG - Intergenic
1055403742 9:75952163-75952185 CTGAAGTATTTAGGGGGAAGTGG - Intronic
1058683288 9:107458559-107458581 CTGAAGTATTTAGGGGTGAAAGG - Intergenic
1059570874 9:115434060-115434082 CTTGAGTCCTTAGGGAAAAATGG - Intergenic
1059793844 9:117669266-117669288 CTGAAGCACTTAGGGATGAAAGG - Intergenic
1060592186 9:124824494-124824516 CTGAAGTATTTAGGGCCAAAGGG - Intergenic
1061015277 9:127977716-127977738 CTGAAGTTCAGAGGCACAAAAGG + Intronic
1186073479 X:5849807-5849829 CTTAAGTACTGAGAGACAGATGG - Intronic
1186828927 X:13370914-13370936 ATGAAATACTTTGAGACAAAAGG - Intergenic
1187095372 X:16142472-16142494 CTGAAATACTTAGGGGTGAAAGG - Intronic
1187175261 X:16890354-16890376 CTGAAGTATTTAGGGGGTAAAGG + Intergenic
1187198069 X:17107384-17107406 CTCAAGTAGTTAGGGACCATAGG + Intronic
1187603084 X:20854139-20854161 CTGAAGTATATAGGGGTAAAGGG - Intergenic
1187764456 X:22624564-22624586 CTGAAGTATTTAGAGATAATGGG + Intergenic
1188522602 X:31055688-31055710 CTGAAGTTGTTAGGGAGTAAAGG + Intergenic
1188579967 X:31699699-31699721 TTGAAGAACTTAGGGGTAAAGGG + Intronic
1189460213 X:41235583-41235605 CTGAAATACTTAGATACAATAGG - Exonic
1189482938 X:41407014-41407036 CTGAAGCAGTTGGGGACAGAGGG - Intergenic
1190461455 X:50680574-50680596 CTGAAGTATTTAGAGGTAAAGGG - Intronic
1190795904 X:53741607-53741629 CTGAAATATTTATGGATAAAAGG - Intergenic
1191199719 X:57766747-57766769 CTGAAGTTCTTGGGGATAGATGG - Intergenic
1192827012 X:74707882-74707904 CTGAAGTACTTAGTTATACATGG - Intergenic
1194579140 X:95649882-95649904 CTGAAGCATTTAGGGATGAAGGG + Intergenic
1194590989 X:95799524-95799546 TTGAAGTAGTTTGGGATAAAAGG - Intergenic
1195304867 X:103571668-103571690 CTAAACTCCTTAGGGAGAAAAGG + Intergenic
1195513870 X:105749192-105749214 CTGAAATATTTAGGGGTAAAGGG + Intronic
1195759371 X:108229292-108229314 CCGTAGGACTTTGGGACAAATGG + Intronic
1195865506 X:109428723-109428745 CTGAAGTATTTAGAGGTAAAAGG + Intronic
1197224719 X:123945549-123945571 CTGAAATATTTAGGGGTAAAAGG - Intergenic
1197326209 X:125097142-125097164 CTTCAGTAGTTAGGGTCAAATGG - Intergenic
1197635085 X:128905418-128905440 CTGAAGCACTTATGGACCCAAGG - Intergenic
1197668552 X:129250059-129250081 CTGAAGTATTAAGGGGTAAAGGG - Intergenic
1197927339 X:131660697-131660719 CTGAAGTATTTAGGGTTAAATGG - Intergenic
1198008478 X:132524380-132524402 CAAAAGTATTTAGGGATAAAAGG + Intergenic
1198029033 X:132737222-132737244 CTGAAGAACATAGTGAAAAATGG + Intronic
1198920863 X:141724930-141724952 CTGATGTCCTTTGGGAGAAATGG - Intergenic