ID: 1063458970

View in Genome Browser
Species Human (GRCh38)
Location 10:6203506-6203528
Sequence CGCTGTGGCCCTTGTCCCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063458968_1063458970 -9 Left 1063458968 10:6203492-6203514 CCGGGCGGCGGGGGCGCTGTGGC 0: 1
1: 0
2: 3
3: 33
4: 327
Right 1063458970 10:6203506-6203528 CGCTGTGGCCCTTGTCCCGGTGG No data
1063458966_1063458970 -3 Left 1063458966 10:6203486-6203508 CCTTGGCCGGGCGGCGGGGGCGC No data
Right 1063458970 10:6203506-6203528 CGCTGTGGCCCTTGTCCCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063458970 Original CRISPR CGCTGTGGCCCTTGTCCCGG TGG Intronic
No off target data available for this crispr