ID: 1063459197

View in Genome Browser
Species Human (GRCh38)
Location 10:6204467-6204489
Sequence CCGGTGATTCAGACCGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 45}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063459197_1063459214 30 Left 1063459197 10:6204467-6204489 CCCTGCTCGGTCTGAATCACCGG 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1063459214 10:6204520-6204542 CCACCCCCATGGTGTGCCCTGGG No data
1063459197_1063459212 29 Left 1063459197 10:6204467-6204489 CCCTGCTCGGTCTGAATCACCGG 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1063459212 10:6204519-6204541 CCCACCCCCATGGTGTGCCCTGG No data
1063459197_1063459207 19 Left 1063459197 10:6204467-6204489 CCCTGCTCGGTCTGAATCACCGG 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1063459207 10:6204509-6204531 TCTCCCCACACCCACCCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063459197 Original CRISPR CCGGTGATTCAGACCGAGCA GGG (reversed) Intronic
904044694 1:27602540-27602562 CCGGGGACCCAGACCCAGCAGGG + Intronic
920259970 1:204682687-204682709 CTGGTGCTTCAGACAGAGAAGGG - Intronic
920456046 1:206101907-206101929 CCGCTGGCTCAGACAGAGCAGGG - Exonic
1062944255 10:1448753-1448775 CTGTTGATTTAGACCAAGCACGG - Intronic
1063092649 10:2881001-2881023 CCAGTGATTCAAACCAAACAGGG + Intergenic
1063459197 10:6204467-6204489 CCGGTGATTCAGACCGAGCAGGG - Intronic
1068431416 10:56936796-56936818 CCTGAGATTCAGACCCACCAAGG - Intergenic
1074405948 10:113180608-113180630 ACTGTGCTTCAGACCCAGCAGGG + Intergenic
1084253905 11:67925144-67925166 CCGGTGATTCTGACTCAGTAGGG - Intergenic
1091326090 11:134689242-134689264 CCTGTGAAGCAGACTGAGCAGGG + Intergenic
1110702564 13:78566163-78566185 GCGGTGATTCAGGCCGGGCGCGG + Intergenic
1125431600 15:39600505-39600527 ACTGTGATTCAGACAGATCATGG - Exonic
1126326101 15:47479265-47479287 GCTGTGCTTCAAACCGAGCAAGG - Intronic
1132618371 16:853178-853200 ACGGTGGTTCAGGCCGAGGAGGG - Intergenic
1132918654 16:2369997-2370019 CTGGTGTTTCAGACGGATCATGG - Intergenic
1133016057 16:2941160-2941182 CCAGTGAGTCAGACTGGGCATGG + Intronic
1133374295 16:5271408-5271430 CCGGTGATTCCGACTCAGTAGGG + Intergenic
1136618537 16:31412996-31413018 CCGGTGAATCAGACACAGCGCGG - Intronic
1139962086 16:70723929-70723951 CCGCTGATTCAGTGGGAGCATGG + Intronic
1142068571 16:88076620-88076642 CCGGAGATGCAGCTCGAGCACGG + Exonic
1142319757 16:89373478-89373500 CCTGTGACTCAGGCCGTGCACGG - Intronic
1142438423 16:90077646-90077668 CCGGTGTTTCCGACTGAGCCGGG + Intronic
1149530602 17:57391960-57391982 ACGGTGATTCAGACCCACTATGG - Intronic
1152439384 17:80296308-80296330 CAGGGTATTCAGACCCAGCACGG - Intronic
1152708536 17:81858626-81858648 CCCGTGCTACAGACGGAGCAGGG + Intronic
925692936 2:6543484-6543506 GCTGTGTTTCAGGCCGAGCATGG - Intergenic
943142929 2:184005423-184005445 CCTGTGATCCAGCCCCAGCATGG - Intergenic
1168870871 20:1127102-1127124 ACGGAGATGCAGACCCAGCAAGG - Intronic
1175597837 20:60249624-60249646 CCGGTGATTCAGTGCCAGCCTGG - Intergenic
1175914240 20:62418403-62418425 CCGGTGAGTCAGGCCAAGCAGGG - Exonic
1184739037 22:46416464-46416486 CTGGTCACTCAGGCCGAGCAAGG + Intronic
959179752 3:102963201-102963223 CCGGTGATGTGGACAGAGCAAGG + Intergenic
961547504 3:127645511-127645533 CCGGGGCTCCTGACCGAGCATGG + Intronic
969800897 4:9564445-9564467 CTGGTGATTCTGACCCAGTAGGG + Intergenic
975473931 4:74800350-74800372 CCGGTGATTCAGTCCTAGTGAGG + Intergenic
986218591 5:5745336-5745358 CCTGAGATTCAGACCCACCAAGG - Intergenic
986465756 5:8021282-8021304 CTGGAGATTCAGAATGAGCAAGG - Intergenic
987575045 5:19715438-19715460 CTGTTGTTTCAGACAGAGCATGG + Intronic
1004187312 6:13432038-13432060 CCGGTGACTCAGCCCCAGCAAGG + Intronic
1006986179 6:38177151-38177173 CCGGAGATATTGACCGAGCAGGG - Intronic
1019873769 7:3790948-3790970 GCTGTGATTCAAACCAAGCAGGG - Intronic
1037434411 8:18847424-18847446 CCAGTGATTAAGGCAGAGCAAGG - Intronic
1047935081 8:129768080-129768102 CCAGTGATCCAGCCCGACCATGG + Intronic
1048808266 8:138261175-138261197 CTGGTGATTCAGACAGAGGTGGG - Intronic
1055558254 9:77497474-77497496 CCTGAGCTTCAGACCTAGCAGGG + Intronic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1195898974 X:109777859-109777881 CCAGAGATCCAGACAGAGCATGG + Intergenic
1200322950 X:155208916-155208938 CCCATGATTCATACCCAGCAAGG + Intronic