ID: 1063462480

View in Genome Browser
Species Human (GRCh38)
Location 10:6223375-6223397
Sequence GTCTAGGGATTCAGCTGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063462480_1063462484 -5 Left 1063462480 10:6223375-6223397 CCAGTGCAGCTGAATCCCTAGAC No data
Right 1063462484 10:6223393-6223415 TAGACAGACCTAAATTGTTTGGG No data
1063462480_1063462489 30 Left 1063462480 10:6223375-6223397 CCAGTGCAGCTGAATCCCTAGAC No data
Right 1063462489 10:6223428-6223450 CCAACTCTAAGTCACCGTGAGGG No data
1063462480_1063462487 29 Left 1063462480 10:6223375-6223397 CCAGTGCAGCTGAATCCCTAGAC No data
Right 1063462487 10:6223427-6223449 CCCAACTCTAAGTCACCGTGAGG No data
1063462480_1063462483 -6 Left 1063462480 10:6223375-6223397 CCAGTGCAGCTGAATCCCTAGAC No data
Right 1063462483 10:6223392-6223414 CTAGACAGACCTAAATTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063462480 Original CRISPR GTCTAGGGATTCAGCTGCAC TGG (reversed) Intronic
No off target data available for this crispr