ID: 1063469043

View in Genome Browser
Species Human (GRCh38)
Location 10:6269747-6269769
Sequence GCTGACTTCTGAAGTTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063469043_1063469045 3 Left 1063469043 10:6269747-6269769 CCTGGACAACTTCAGAAGTCAGC No data
Right 1063469045 10:6269773-6269795 TCAGAATGCATAAATGAAGAGGG No data
1063469043_1063469044 2 Left 1063469043 10:6269747-6269769 CCTGGACAACTTCAGAAGTCAGC No data
Right 1063469044 10:6269772-6269794 GTCAGAATGCATAAATGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063469043 Original CRISPR GCTGACTTCTGAAGTTGTCC AGG (reversed) Intergenic
No off target data available for this crispr