ID: 1063479937

View in Genome Browser
Species Human (GRCh38)
Location 10:6366590-6366612
Sequence CACCTTATGCAGAGGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063479937_1063479942 -4 Left 1063479937 10:6366590-6366612 CCCTTCTCCCTCTGCATAAGGTG No data
Right 1063479942 10:6366609-6366631 GGTGCAATGTGGAGTGCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063479937 Original CRISPR CACCTTATGCAGAGGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr