ID: 1063481754

View in Genome Browser
Species Human (GRCh38)
Location 10:6382521-6382543
Sequence GGTTTACGGAAGGTGAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063481747_1063481754 7 Left 1063481747 10:6382491-6382513 CCTTGGGACAAGGAGCTGTTTTG No data
Right 1063481754 10:6382521-6382543 GGTTTACGGAAGGTGAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063481754 Original CRISPR GGTTTACGGAAGGTGAGGCT GGG Intergenic
No off target data available for this crispr