ID: 1063484883 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:6410555-6410577 |
| Sequence | GGAAATGCACAGGGGCATCT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1063484875_1063484883 | 5 | Left | 1063484875 | 10:6410527-6410549 | CCCAGGGCTCTAAGTAGCAGTGG | No data | ||
| Right | 1063484883 | 10:6410555-6410577 | GGAAATGCACAGGGGCATCTGGG | No data | ||||
| 1063484877_1063484883 | 4 | Left | 1063484877 | 10:6410528-6410550 | CCAGGGCTCTAAGTAGCAGTGGT | No data | ||
| Right | 1063484883 | 10:6410555-6410577 | GGAAATGCACAGGGGCATCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1063484883 | Original CRISPR | GGAAATGCACAGGGGCATCT GGG | Intergenic | ||
| No off target data available for this crispr | |||||