ID: 1063484883

View in Genome Browser
Species Human (GRCh38)
Location 10:6410555-6410577
Sequence GGAAATGCACAGGGGCATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063484875_1063484883 5 Left 1063484875 10:6410527-6410549 CCCAGGGCTCTAAGTAGCAGTGG No data
Right 1063484883 10:6410555-6410577 GGAAATGCACAGGGGCATCTGGG No data
1063484877_1063484883 4 Left 1063484877 10:6410528-6410550 CCAGGGCTCTAAGTAGCAGTGGT No data
Right 1063484883 10:6410555-6410577 GGAAATGCACAGGGGCATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063484883 Original CRISPR GGAAATGCACAGGGGCATCT GGG Intergenic
No off target data available for this crispr